BIOCHEMISTRY (LOOSELEAF)-W/ACCESS
9th Edition
ISBN: 9781319425784
Author: BERG
Publisher: Macmillan Higher Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 25P
Interpretation Introduction
Interpretation:
To determine the base pair which occupies the position in each daughter strands, results from two rounds and one round replication.
Concept introduction:
The conversion of cytosine to uracil occurs during spontaneous deamination, which is created from DNA with the help of enzyme uracil-DNA glycosylase, and results in an error-free repair.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
True or False. The first step of DNA repair is catalyzed by enzymes unique to the process and more general enzymes catalyze later steps of the process.
Complements. The sequence of part of an mRNA is
5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'
5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3'
What is the sequence of the DNA coding strand? Of the DNA template
strand?
True or False. Just write T if it is true and F if it is false.
In E. coli both RNA and protein synthesis take place in the cytoplasm.
Okazaki fragments are ssDNA CHAINS OF 100-200 nucleotides long, primed by very short RNA primers in bacteria.
In eukaryotic gene, the coding sequences are known as introns while the intervening sequences are the exons.
The central dogma refers to the fact that proteins are products of information encoded in RNA using a DNA intermediate.
The ends of the linear chromosomes are maintained by telomerase to prevent it from shortening during mitosis.
The Shine Delgarno sequence is where the RNA pol binds during transcription in prokaryotes
The sigma subunit of the E. coli RNA polymerase confers specificity to transcription.
Both DNA replication and transcription follow a 5’ to 3’ direction of polarity.
Nucleosomes are the structural unit of chromatin.
In the lagging strand, the enzyme X removes RNA primers attached by PRIMASE and this gap is then filled…
Chapter 4 Solutions
BIOCHEMISTRY (LOOSELEAF)-W/ACCESS
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Close contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved residues come within van der Waals contact of C-2'C-2' of the bound nucleotide. What is the potential significance of this interaction?arrow_forwardANSWER IT ASAP. I PROMISE TO UPVOTE. ANSWER THEM ALL FOR AN UPVOTE. THANKYOU.arrow_forwardGenetics. How to identify what wrong with itarrow_forward
- True or False. Topoisomerase I does not require ATP to break and rejoin DNA strands because the energy of the phospho-diester bond is stored transiently in a phospho-tyrosine linkage in the enzyme’s active site. Explain your answer in 2-3 sentences.arrow_forwardTrue or False. Do single-stranded DNA strands stabilize other strands?arrow_forwardcan you please do this. thank youarrow_forward
- Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to- 3'5'-to-3' direction. Other helicases have been reported to move in the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why you would expect helicases to move in one direction or the other?arrow_forwardCentral Dogma Application: Using the basic concept of Process of central dogma provide the following answer in the given DNA sequence on how genetic information flow. IV. Given DNA Sequence: ATCGATCGCGATCGATTACATATGCGCCCCTTTTTCCCGGGAATAATGCTAGCTAGCATGCATCAG Product of Replication: ( Product of Transcription: Product of Translation: {.arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license