(a)
Interpretation:
The reason for the doubt in the reported amino acid substitution by a molecular geneticist needs to be explained.
Concept introduction:
A sequence of three DNA or RNA nucleotides is called a codon. The three-
(b)
Interpretation:
The amino acid sequence, more palatable to the molecular geneticist needs to be determined.
Concept introduction:
A sequence of three DNA or RNA nucleotides is called a Codon. The three-nucleotide sequence or codon corresponds to a specific amino acid, and these codons are interpreted by the tRNA. The tRNA also contains the anticodon which recognizes and interprets the codons on the mRNA. The tRNA binds to its corresponding codon on the ribosome and they decode the mRNA until the whole sequence is coded. The sequences can be mutated, and they can give rise to new proteins and genes.
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
BIOCHEMISTRY (LOOSELEAF)-W/ACCESS
- AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forwardStructure of lactam.. 1) Why this lactam would be evolutionarily selected against? a. Amino acids with rings are selected against. b. The lactam would cause cleavage of the peptide. c. There are not enough codons to encode an additional amino acid. d. The bulkiness of the side chain. 2) Lysine is similar to ornithine. Why does lysine not form a lactam? a. Infrequency of lysine occurring in proteins. b. Size of the ring formed. c. Charge on the primary amine. d. Formation of salt bridges with anionic amino acids..arrow_forwardRead it carefully.. Draw only correct diagrams.. In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C). 1. Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction. 2. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.arrow_forward
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardH2N 1.) Look carefully at this nucleotide: N: N- Но-Р-О OH a.) Number the carbons in the sugar group. (Remember the "prime" symbols.) b.) Is this a purine or a pyrimidine? How do you know? c.) Would this nucleotide be used for DNA or RNA? How do you know? (Be specific.) d.) Is this nucleotide ready to be used for DNA replication or RNA transcription? Why/why not? e.) If this nucleotide were incorporated into a growing DNA or RNA strand, where would the next added nucleotide be attached to this one?arrow_forward(5) AAG a. What is indicated by label (2) in the figure above? b. What is indicated by label (3) in the figure above? c. What is the function of part d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that will recognize all the codons for this amino acid in (c).arrow_forward
- Need help. Which one of the following statements is FALSE? Group of answer choices A.Beta-pleated sheets are part of the secondary structure of proteins B.The nitrogenous bases of DNA are located on the inside because they are hydrophobic in character C.The peptide bond is formed by dehydration synthesis D.Alpha helices are stabilized by attraction between the amino acid R groups E.The peptide bond is rigid and planar and has partial double bond characterarrow_forward. Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.arrow_forwardPlease help! Sketch a titration curve of the peptide Ala-Tyr-Gln-Met-Asp-His from pH=0 to 14 up to 5 equivalnets of KOH (Please type answer)arrow_forward
- This is DNA. Locate the nitrogen bases (nitrogens are blue). Where are they located in the molecule?Locate the sugars and phosphates, and describe their location. Adjacent nucleotides are linked by covalent phosphodiester bonds (-O-P-O-) produced by a condensation reaction. What parts of the adjacent nucleotides are linked by phosphodiester bonds?Two nitrogenous bases extending towards the middle of the double helix. Are there any covalent bonds between these bases?If there are no covalent bonds between these bases, what other kinds of bonds might hold the two strands of the double helix together?arrow_forward1Need help:. draw valine-aminoacyl tRNA synthetase. Show the tRNAs and the valine amino acid. You can use the one-letter code for valine (V) and do not have to draw the amino acid structure. Label the tRNA and amino acid binding sites on the enzyme. Explain the function of valine-aminoacyl tRNA synthetase and explain why there are 20 related enzymes in every cell.arrow_forwardBased. On the table explain the difference of net charge between 168.1 and the 168.10 molecular clones. Consider the initial net charge of the 168.1 clone and what ionizable amino acids contribute to such charge. Assume that histidine is neutral due to the pharrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON