Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 19P
Two viral genomes are sequenced, and the following percentages of
Genome
Genome
Are the DNA molecules in each genome single- stranded or double-stranded?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Assume you isolate a single stranded (+) RNA virus. When you examine the proteins in the virus, you find that it does NOT contain replicase enzymes within its capsid. Which of the following is true?
This virus must have a gene that encodes replicase.
This virus will not be able to enter a host cell.
Its genome cannot be translated (the process of translation) by the host cell ribosomes.
A DNA copy of the viral genome has to be made before viral genes are expressed.
This virus must lack surface antigens.
The table below shows the properties of the genomes of
three different viruses. The data were obtained as
follows: Nuclease sensitivity was measured by the ability
of deoxyribonuclease (DNase) or ribonuclease (RNase)
to destroy the genome (a “+" means sensitivity). The
ability of the genome to act as mRNA was tested by
incubating it in a cell-free system. If amino acids were
incorporated into protein, the data are shown as a
Finally, the virus particles were tested for the presence
of a virion polymerase. If an enzyme was present, the
data show whether it could polymerize deoxynucleotide
triphosphates (DNTPS) or nucleoside triphosphates
(NTPS).
"+.
Genome Properties
Nuclease
Virion
Can
Genome
Sensitivity?
Polymerase?
Be an
mRNA?
Virus DNase RNase
With
With
DNTPS NTPS
#1
-
-
#2
-
-
#3
For each virus, indicate the strategy of the genome,
using the Baltimore classification. What is the nature of
the product of the virion polymerase when present?
+
+
+
+
+ +
What is the significance of the length of a typical viral genome?
Chapter 7 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- How many protein subunits would be present in a complex icosahedral virus particle with a triangulation (T) number of 8?arrow_forwardThe DNA sequence of the genome of a virus is known and contains equal number of A, TG and C. The genome is composed of double stranded DNA molecule. It is 10Kb in length. If one searches the genome for the presence of the following sequence 5'-AAAAAA-3'/3'-TTTTTT-5', predict the number of such stretches that are likely to occur. (1Kb = 1000 base pairs). a) Two b) Eight c) Sixteen d) Thirty twoarrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forward
- You are studying RNA viruses and have discovered one that grows well in a culture of eukaryotic cells. You know that the virus is a single-stranded RNA virus, but you don't know if it is positive or negative stranded. Your lab-mate says, "Well, just treat your cell culture with cyclohexamide and see if the virus replicates its genome." You know that cyclohexamide inhibits protein elongation by binding to eukaryotic ribosomes. What is the basis of your lab-mate's suggestion?arrow_forwardChemical composition analysis of a viral genome showed 22.1% A, 27.9% C, 27.9% G, and 22.1% U. Based on this, the viral genome is most likely made of: a) single-stranded (ss) DNA b) double-stranded (ds) DNA c) SSRNA d) dsRNA e) plasmid DNAarrow_forwardGiven that COVID19 has a single strand RNA for its genome, the number of rounds required to complete replicating 3 viable virus particles? a) 3 b) 4 c) 5 d) 6 e) 9arrow_forward
- Which biological system contains a protein nucleocapsid surrounding 2 antiparallel polynucleotide strands (held together by hydrogen bonds), with deoxyribose sugars, but no ribose sugars? a single-stranded RNA viroid (like avocado sun blotch viroid) a double-stranded RNA virus (like the reovirus family) a single-stranded DNA virus (like fX174 virus of E. coli) a double-stranded DNA virus (like the smallpox virus) a single-stranded RNA virus (like tobacco mosaic virus)arrow_forwardA single DNA molecule contains two specific target sites separated by an intervening sequence. If site-specific recombination between these sites causes the intervening sequence to be released as a separate circular DNA molecule containing one target site, then the sites were oriented in A) opposite directions causing excision. B) the same direction causing excision. C) opposite directions causing integration. D) the same direction causing integration. E) the same direction causing inversion.arrow_forwardWhich of the following statements about DNA polymerase I are true? 1) It requires both template DNA and a primer. 2) It can copy and join the ends of single-stranded circular DNA. 3) It uses only DNA as a template primer. 4) With respect to linear DNA, it copies only the 5′ end and then dissociates. a) Only statements 1 and 3 are true. b) Only statements 1 and 4 are true. c) Only statements 1, 2, and 4 are true. d) All of the listed statements are true.arrow_forward
- A particular animal virus requires the use of DNA polymerase from its host, since it does not possess its own DNA polymerase enzyme. Which of the following assumptions in A-D would likely be correct regarding this virus? A) O This virus could not be a retrovirus type. B) OIt could be a (-) ss RNA virus. C) O It could be a (+) ss RNA virus. D) O The vVirus life cycle very likely includes going to the host cell nucleus. E) O All ofA-D are correct assumptions.arrow_forwardWhich of the following statements is false? a) the bacterial chromosome is usually circular b) the bacterial chromosome has a single origin of replication c) the bacterial chromosome consists of a single molecule of DNA d) plasmids are small DNA molecules that occur in bacteria but are not essential - for normal function. e) Most bacterial genomes consist of fewer than 1,000 genesarrow_forwardRNA-dependent RNA polymerase performs which of the following functions? O 1) Uncoats the viral genome 2) transcribes retroviral RNA genomes into DNA 3) Replicates RNA into RNA O 4) Replicates DNA into RNA 5) Shuttles RNA genomes into the nucleus for assemblyarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY