Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 24P
Bloom syndrome (OMIM
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
How many base pairs are changed in the sickle cell mutation?
Lay out the genetics of Nicholas’s case, including where the mutationoccurred, what exact nucleotide defect was present, why this was aserious type of defect, and why he was so affected by the mutationbut his mother was not.
The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairing
Chapter 7 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Trichothiodystrophy is a human inherited disorder characterized by premature aging, including osteoporosis, osteosclerosis, early graying, infertility, and reduced life span. The results of studies showed that the mutation that causes this disorder occurs in a gene that encodes a DNA helicase. Propose a mechanism for how a mutation in a DNA helicase might cause premature aging. Be sure to relate the symptoms of the disorder to possible functions of the helicase enzyme.arrow_forwardDNA repair enzymes that correct deamination and depurination must preferentially recognize these defects on newly synthesized strands. Explain in 1-2 sentences.arrow_forwardAlthough most cases of cystic fibrosis are inherited in an autosomal recessive manner, it possible that cystic fibrosis can arise spontaneously in some patients. Determine whether each of the scenarios below is most consistent with inherited or spontaneous CFTR mutations. Errors in CFTR were introduced in [ Choose ] replication. [ Choose ] Both parents carry the same mutation. Spontaneous mutation Inherited mutation Not every cell of the patient has the [ Choose ] mutation. One parent has two normal copies of [ Choose ] CFTR. Cousins also have the same CFTR [ Choose ] mutation. > >arrow_forward
- The ethidium bromide added to the agarose gels intercalates within the base pairs of the DNA double helix as it travels through the gel. Exposure to UV light causes the ethidium bromide to fluoresce, thus allowing for visualization of any DNA. How might this tendency of ethidium bromide to intercalate within the DNA double helix attribute to its carcinogenic properties in living organisms?arrow_forwardThe following is a list of mutational changes. For each of the specific mutations described, indicate which of the following terms could apply, either as a description of the mutation or as a possible cause. More than one term from the right column can apply to each statement in the left column. 1. an A-T base pair in the wild-type gene is changed to a G-C pair 2. an A-T base pair is changed to a T-A pair a. transition b. base substitution c. transversion 3. the sequence AAGCTTATCG is changed to d. inversion AAGCTATCG c. translocation f. deletion 4. the sequence AAGCTTATCG is changed to AAGCTTTATCG g. insertion 5. the sequence AACGTTATCG is changed to AATGTTATCG h. decamination 6. the sequence AACGTCACACACACATCG is i. X-ray irradiation changed to AACGTCACATCG j. intercalator 7. the gene map in a given chromosome arm is changed from bog-rad-fox1-fox2-try-duf (where foxl and fox2 are highly homologous, recently diverged genes) to bog-rad-fox1-fox3- fox2-try-duf (where fox3 is a new gene…arrow_forwardThe cancer drug melphalan is an alkylating agent of the mustard gas family. It acts in two ways: by causing alkylation of guanine bases and by cross linking DNA strands together. Describe two ways in which melphalan might kill cancer cells. What are two ways in which cancer cells could repair the DNA-damaging effects of melphalan?arrow_forward
- 11:29 Protein 6-10092015113530.pdf https:api.schoology.comv1attachment169963838... Name Class Date 2. How are enzymes involved in this process? 3. hаppens anzips"? 4. Why is it important that exact copies of DNA be made? 5. Suppose that a sequence of one DNA strand is T-A-C-A-A-C-G-T-G. What is the corresponding sequence on the other strand? E Concept Mapping The construction of and theory behind concept mapping are discussed on pages vil-ix in the front of this Study Guide. Read those pages carefully. Then consider the concepts presented in Section 7-1 and how you would organize them into a concept i page 74. Notice that the concept map has been started for you. Add the key Now look at the concept map for Chapter 7 on concepts you are important Secti When you have finished the chapter, you will have a completed concept map. 69 1 of 1arrow_forwardIdentify the type of mutation shown Original Sequence: GGC TAC ATG GAA Mutated Sequence: GGC TAA TGG AAarrow_forwardSilent mutations that occur in DNA are quite common in living cells and usually involve no effects onphenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provideanswers for the following questions?1) Define the silent mutation in DNA? (2.5 marks)2) What is the codon usage bias? (2.5 marks)3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect onthe phenotype and provide a brief description of its molecular characteristics? (10.0 marks)arrow_forward
- What entropic factor destabilizes helical DNA at high temperature?arrow_forwardWhat is the methyl group-containing nucleobase composition of a double- stranded eukaryotic DNA with 52,000 bases that contains 22% bicyclic nucleobases characterized to have both an amino group and a keto group? (Instructions: Do NOT put spaces or commas or additional words/letters/units; Type in your answer in NUMERICAL FORM with the following format: 1234567)arrow_forwardBased on standard MS- LS3-1: Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length). Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish? Can you answer in the following format? 1- Structure How Structure and Function is Affected by Mutations in Blind Fish Eyes Scales Taste Cells Lateral Line 2- Model to explain what causes these changes: Change: ______________ Adapting an Organism to the Dark Cause: ________________ Stop the Growth of Eyes Effect: ___________________ Fish with Heightened Other Senses References: Video: Rare Blind Cave Fish in Mexican Cave System https://www.youtube.com/watch?v=MWdtGuDd8z0 Fact Sheet: Blind Cave Fish https://www.denverzoo.org/animals/blind-cave-fish Information: Mexican Tetra…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY