![Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135564172/9780135564172_largeCoverImage.gif)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 8P
Figures
a. What kind of bond joins the C to the G within a single strand?
b. What kind of bonds join the C in one strand to the G in the complementary strand?
c. How many phosphodiester bonds are present in this DNA duplex?
d. How many hydrogen bonds are present in this DNA duplex?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC
Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC
Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence:
Name and explain two different ways in which DNA can be damaged.
Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
Suppose the following base sequence was found in a 20-base DNA polymer.
3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5'
a. What would be the first 5 bases at the 3' end of the complementary strand?
b. What would be the first 10 bases at the 5' end of the complementary
strand?
c. Assuming the presence of the complementary strand, what is the
percentage composition of the polymer with respect to the A-T base pair?
with respect to the G-C base pair?
d. In the given segment in problem 1, illustrate and indicate the direction of the
synthesis of:
i. a 5-nucleotide RNA primer
ii. a 5-nucleotide Okazaki fragment
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate
groups are filled circles.
A. Is this a DNA or an RNA Molecule?
B. Where is the 3’ end of this tetranucleotide?
C. Given that the DNA strand which served as a template for the synthesis of this
tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Chapter 7 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?arrow_forwardExplain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA molecule without breaking the hydrogen bonds that hold the bases together. indicate how, through such contacts, a protein can distinguish a T-A from a C-G pair. indicate the parts of the nucleotide base pairs that could form noncovalent interactions— hydrogen bonds, electrostatic attractions, or hydrophobic interactions -with a DNA-binding protein.arrow_forwardExplain why two metal ions play important role on the palm domain of DNA polymerase.arrow_forward
- Here is a DNA coding strand’s sequence and direction: 5’-ATGCCGATATAG-3’ . What would be the amino acid sequence in the polypeptide encoded by this DNA?arrow_forwardSuppose that a length of double-stranded DNA is 2520 base pairs long. Calculate the number of helical turns if the DNA were in the B form, given that B-form DNA contains 10.5 base pairs B form: helical turns per helical turn. Calculate the number of helical turns if the DNA were in the Z form, given that Z-form DNA contains 12 base pairs per Z form: helical turns helical turn.arrow_forwardDraw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this dinucleotide.arrow_forward
- The template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forwardOne of the original structures proposed for DNA had all the phosphate groups positioned at the center of a long fiber. Give a reason why this proposal was rejectedarrow_forwardSuppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)arrow_forward
- Single-stranded binding proteins (SSBPs) bind to single-stranded DNA at the replication fork and prevent formation of short hairpin sequences that would otherwise impede DNA synthesis. What sorts of sequences in single-stranded DNA might be able to form a hairpin? Write out an example of a sequence that could form a 5-nucleotide hairpin loop, and draw it.arrow_forwardThe sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated. 5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3' a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals d) Suppose the bracketed bold [a] were…arrow_forwardThe complementarity of its two strands is the underlying reason that DNA can be faithfully copied. Propose alternative chemical structures that could be faithfully copied.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license