![Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135564172/9780135564172_largeCoverImage.gif)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 23P
Why do the genomes of eukaryotes, such as Drosophila, need to have multiple origins of replication, whereas bacterial genomes, such as that of E. coli, have only a single origin?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
If the rate of replication in a particular prokaryote is 900 nucleotides per second, how long would it take 1.2 million base pair genomes to make two copies?
A major difference between prokaryotes and eukaryotes is the presence of a nucleus. What advantages and disadvantages may occur with having a cell’s genome packaged in a nucleus?
In what ways does chromosomal replication in eukaryotes differ from DNA replication in prokaryotes?
Chapter 7 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In bacteriophages and bacteria, the DNA is almost always organized into circular (closed loops) chromosomes. Phage l is an exception, maintaining its DNA in a linear chromosome within the viral particle. However, as soon as this DNA is injected into a host cell, it circularizes before replication begins. What advantage exists in replicating circular DNA molecules compared to linear molecules, characteristic of eukaryotic chromosomes?arrow_forwardA large portion of the human genome is transposons. Collectively, they are most likely: A) an equal mix of DNA and retrotransposons B) mostly DNA transposons because they are found in DNA C) mostly retrotransposons because they copy themselves each time they move D) mostly DNA transposons because they can cut themselves outarrow_forwardWhat are some of the ways that organisms use to ensure the fidelity of DNA replication? Why is it important that the fidelity of DNA replication is an evolutionary balance between faithful replication and the existence of some errors? Escherichia coli and other bacteria methylate adenines on the original strand to distinguish the original strand from the newly replicated strand of DNA. Why is this distinction important?arrow_forward
- What enzymatic features of DNA polymerase prevent it from replicating one of the DNA strands at the ends of linear chromosomes? Compared with DNA polymerase, how is telomerase different in its ability to synthesize a DNA strand? What does telomerase use as its template for the synthesis of a DNA strand? How does the use of this template result in a telomere sequence that is tandemly repetitive?arrow_forwardWhy do eukaryotes need multiple origins of replication?arrow_forwardIs eukaryotic replication bidirectional or unidirectional?arrow_forward
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardWhat are some reasons why, in multicellular eukaryotes, genome size is not necessarily related to number of protein-coding genes or organismal complexity?arrow_forwardWhat is the end-replication problem? Why, in the absence of telomerase, do the ends of linear chromosomes get progressively shorter each time the DNA is replicated?arrow_forward
- What Is The Origin Of Replication? How many are found in prokaryotes and how many are found in eukaryotes?arrow_forwardWhy are some eukaryotic genomes so large?arrow_forwardWhich of the followings statements are true about DNA polymerase? 1.) It can only go in one direction, meaning the lagging strand can't be synthesized continuously. 2.) It cannot start a DNA strand from scratch, so another enzyme is needed to create "primers" as a starting point. 3.) It cannot copy epigenetic marks (such as methyl groups) on its own; these must be "copied" onto the daughter DNA strand by other enzymes after DNA replication. 4.) All of the abovearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology - Intro to Cell Structure - Quick Review!; Author: The Organic Chemistry Tutor;https://www.youtube.com/watch?v=vwAJ8ByQH2U;License: Standard youtube license