Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 7, Problem 9P

Consider the sequence 3' -ACGCTACGTC- 5' .

a. What is the double-stranded sequence?

b. What is the total number of covalent bonds joining the nucleotides in each strand?

c. What is the total number of noncovalent bonds joining the nucleotides of the complementary strands?

Blurred answer
Students have asked these similar questions
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated. 5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3' a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals d) Suppose the bracketed bold [a] were…

Chapter 7 Solutions

Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY