![Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135564172/9780135564172_largeCoverImage.gif)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 7, Problem 9P
Consider the sequence
a. What is the double-stranded sequence?
b. What is the total number of covalent bonds joining the
c. What is the total number of noncovalent bonds joining the nucleotides of the complementary strands?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate
groups are filled circles.
A. Is this a DNA or an RNA Molecule?
B. Where is the 3’ end of this tetranucleotide?
C. Given that the DNA strand which served as a template for the synthesis of this
tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Suppose the following base sequence was found in a 20-base DNA polymer.
3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5'
a. What would be the first 5 bases at the 3' end of the complementary strand?
b. What would be the first 10 bases at the 5' end of the complementary
strand?
c. Assuming the presence of the complementary strand, what is the
percentage composition of the polymer with respect to the A-T base pair?
with respect to the G-C base pair?
d. In the given segment in problem 1, illustrate and indicate the direction of the
synthesis of:
i. a 5-nucleotide RNA primer
ii. a 5-nucleotide Okazaki fragment
The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated.
5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3'
a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends
b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends
c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals
d) Suppose the bracketed bold [a] were…
Chapter 7 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Do any strands of nucleic acid exist in nature in which part of the strand is DNA and part is RNA? If so, a.describe when such strands of nucleic acid are synthesized. Is the RNA component at the 5' end or at the 3' end?arrow_forwardTo create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?arrow_forwardGiven the following sequence for one strand of a double-stranded oligonucleotide: 5'ACCGTAAGGCTTTAG3' (a) Write the sequence for the complementary DNA strand. (b) Suppose you knew that the strand shown above had phosphate on both ends. Using an accepted nomenclature, write the sequence so as to show this. (c) Write the sequence of the RNA complementary to the strand shown above.arrow_forward
- Draw a two-stranded anti-parallel beta-sheet where each strand is 5 amino acids long. Use “R” to show the placement of the side chains and indicate H bonds. Also, use wedges and dashes to indicate directionality of R and H.arrow_forwardThe template strand of a segment of double-helical DNA contains the sequence – 5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’ a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends. b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends. c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?arrow_forwardSuppose that a length of double-stranded DNA is 2520 base pairs long. Calculate the number of helical turns if the DNA were in the B form, given that B-form DNA contains 10.5 base pairs B form: helical turns per helical turn. Calculate the number of helical turns if the DNA were in the Z form, given that Z-form DNA contains 12 base pairs per Z form: helical turns helical turn.arrow_forward
- Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forwarda. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?arrow_forward1) a) Sketch an A-form helix and a B-form helix, highlighting the differences between them. Indicate the bases and backbone as lines. Label the major and minor grooves. 2) Sketch a ribose in the pucker that is expected in RNA. 3) Sketch a 2’ deoxyribose in the pucker that is expected in DNA. 4) Draw a GCG triplet (GC Watson-Crick), with perfect geometry. Draw the bases only, with dR’s at the N-9 positions of the purines (Gs) and at the N1 positions of the pyrimidine (C)arrow_forward
- DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’a. what is the non-template/sense/coding strand?b. What is the arrangement of the m-RNA?c. What's the chain arrangement of the amino acids that will be made according to the order of the RNA?d. If on the non-coding strand of DNA there is suddenly one T base that sneaks into the 4th sequence (from the left), or causes a mutation, then how will the RNA be formed?e. What's the chain arrangement of the amino acids produced by this mutation?arrow_forwardThe sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features – capitalization does not affect the nucleotide indicated. 5’…atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc…3’ a. Underneath that strand write the sequence of the strand of DNA it would be paired with in a doublestranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, U-uracil and C-cytosine and remember to label the 5’ and 3’ ends. b. Next, write the sequence of a possible mRNA transcript of the double stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5’ and 3’ ends. c. Using the genetic code, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein below the mRNA sequence in (b) and label the amino and carboxy terminals d. Suppose the bracketed, bold [a] were mutated to be a t. Write the new sequence of your mRNA transcript…arrow_forwardDraw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this dinucleotide.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY