Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 3P
The DNA sequence of one strand of a gene from three independently isolated mutants is given here (5′ ends are at left). Using this information, what is the sequence of the wildtype gene in this region?
mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCG
mutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCG
mutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
the one above: Replicate this sense strand to create a double-stranded DNA helix
TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT
Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence?
TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT
2.
Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon.
3.
How many amino acids were changed
in the mutated polypeptide?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Below is a portion of an exon from a gene that encodes protein X in the genome of the plant Arabidopsis.
Wildtype DNA3’ TTC AAT GCT CCG AAT ACC 5’ template strand5’ AAG TTA CGA GGC TTA TGG 3’ non-template strand
A new strain (Strain B) of Arabidopsis is identified with the same region of the gene coding for protein X:
3’ TTC AAT GCT CCC AAT ACC 5’ template strand5’ AAG TTA CGA GGG TTA TGG 3’ non-template strand
Compare the two DNA sequences and look for any differences. Based on what you find
a.
There is no mutation in Strain B compared to Strain A.
b.
After the point of the mutation, all the amino acids encoded by the Strain B template will be different than the Strain A protein X.
c.
Protein X made from the Strain B template will be much shorter than protein X made from the Strain A template
d.
Protein X from Strain B will have one amino acid difference that would not affect protein function.
e.
There is a mutation but there will not be any difference in the…
Chapter 7 Solutions
Genetics: From Genes to Genomes
Ch. 7 - The following is a list of mutational changes. For...Ch. 7 - What explanations can account for the following...Ch. 7 - The DNA sequence of one strand of a gene from...Ch. 7 - Among mammals, measurements of the rate of...Ch. 7 - Over a period of several years, a large hospital...Ch. 7 - Suppose you wanted to study genes controlling the...Ch. 7 - In a genetics lab, Kim and Maria infected a sample...Ch. 7 - The results of the fluctuation test Fig. 7.5 were...Ch. 7 - The following pedigree shows the inheritance of a...Ch. 7 - Autism is a neurological disorder thought to be...
Ch. 7 - Like the yellow Labrador retrievers featured in...Ch. 7 - Remember that Balancer chromosomes prevent the...Ch. 7 - Figure 7.14 shows examples of base substitutions...Ch. 7 - Figure 7.14a shows the mutagen 5-bromouracil 5-BU,...Ch. 7 - So-called two-way mutagens can induce both a...Ch. 7 - In 1967, J. B. Jenkins treated wild-type male...Ch. 7 - When a particular mutagen identified by the Ames...Ch. 7 - Prob. 18PCh. 7 - The Ames test uses the reversion rate His- to His...Ch. 7 - The mutant FMR-1 allele that causes fragile X...Ch. 7 - The physicist Stephen Hawking, famous for his...Ch. 7 - Aflatoxin B1 is a highly mutagenic and...Ch. 7 - In human DNA, 70 of cytosine residues that are...Ch. 7 - Bromodeoxyuridine BrdU is a synthetic nucleoside...Ch. 7 - Albinism in animals is caused by recessive...Ch. 7 - a. In Figure 7.22b, what can you say about the...Ch. 7 - Imagine that you caught a female albino mouse in...Ch. 7 - Plant breeders studying genes influencing leaf...Ch. 7 - In humans, albinism is normally inherited in an...Ch. 7 - a. Seymour Benzers fine structure analysis of the...Ch. 7 - a. You have a test tube containing 5 ml of a...Ch. 7 - Prob. 32PCh. 7 - The rosy ry gene of Drosophila encodes an enzyme...Ch. 7 - Nine rII- mutants of bacteriophage T4 were used in...Ch. 7 - In a haploid yeast strain, eight recessive...Ch. 7 - In Problem 24, you learned that Bloom syndrome is...Ch. 7 - The pathway for arginine biosynthesis in...Ch. 7 - In corn snakes, the wild-type color is brown. One...Ch. 7 - In a certain species of flowering plants with a...Ch. 7 - The intermediates A, B, C, D, E, and F all occur...Ch. 7 - In each of the following cross schemes, two...Ch. 7 - Prob. 42PCh. 7 - The following complementing E. coli mutants were...Ch. 7 - In 1952, an article in the British Medical Journal...Ch. 7 - Mutations in an autosomal gene in humans cause a...Ch. 7 - Antibodies were made that recognize six proteins...Ch. 7 - Prob. 47PCh. 7 - Prob. 48PCh. 7 - In addition to the predominant adult hemoglobin,...Ch. 7 - Most mammals, including New World primates such as...Ch. 7 - Humans are normally trichromats; we have three...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’arrow_forwardBelow is a portion of an exon from a gene that encodes protein Y in the genome of the plant Brassica. Wildtype DNA3’ CTT AAT GCT CCG AAT CCA 5’ template strand5’ GAA TTA CGA GGC TTA GGT 3’ non-template strand A new strain (Strain X) of Brassica is identified with the same region of the gene coding for protein Y:3’ CTT AAT GCT GCG AAT CCA 5’ template strand5’ GAA TTA CGA CGC TTA GGT 3’ non-template strand Compare the sequence of Wildtype with Strain X DNA, and note the following: Whether there is a mutation. If there is a mutation, what is the type of mutation (be as specific as possible) and explain the rationale for your decision. Assuming this is the only difference between the Wildtype and Strain X, describe the potential impact of the mutation on the structure and function of the protein.arrow_forwardFor the following sequence design the forward and reverse primer... explain and justify your answer. Gene of Interest: a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…arrow_forward
- What restriction enzyme (or enzymes) would you use to cut the following... (Gene of Interest is Bolded) 1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg…arrow_forwardConsider the following wild-type and mutant sequences:Wild-type ....CTTGCAAGCGAATC....Mutant ....CTTGCTAGCGAATC....arrow_forwardWhat would be a primer sequence synthesized from the following DNA sequence: 5'-ACGTG-3'? out of 5'-GTGCA-3', 5'-CACGT-3', 5'-CACGU-3', 5'-TGCAC-3', or 5'-ACGTG-3'?arrow_forward
- TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTTarrow_forwardBased on the following wild type sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table). Wild Type: GUC GCC GAC GAG AGG Mutant 1: GUC GCC AGA CGA GAG G Mutant 2: GUC GCC ACG AGA GG Mutant 3: GUC GCC AAC GAG AGG Mutant 4: GUA GCC GAC GAG AGG Mutant 5: GUC GCC GAC UAG AGGarrow_forwardHere another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'arrow_forward
- The sequence below shows 140bp of a double-stranded DNA sequence coding for histone H2A. What two primers could be used to amplify the whole 140bp sequence in a PCR reaction? 1 70ATGTCTGGACGTGGCAAGCAGGGAGGCAAAGCCCGCGCTAAGGCCAAGACTCGCTCTTCTAGGGCCGGTCTACAGACCTGCACCGTTCGTCCCTCCGTTTCGGGCGCGATTCCGGTTCTGAGCGAGAAGATCCCGGCCAG 71 140 TCCAGTTCCCCGTGGGCCGAGTGCACCGCCTGCTCCGCAAAGGCAACTATGCCGAGCGGGTCGGGGCCGGAGGTCAAGGGGCACCCGGCTCACGTGGCGGACGAGGCGTTTCCGTTGATACGGCTCGCCCAGCCCCGGCC a. TACAGACCTGCACCGTTC and GGCCGGGGCTGGGCGAGC b. ATGTCTGGACGTGGCAAG and CCGGCCCCGACCCGCTCG c. ATGTCTGGACGTGGCAAG and GCTCGCCCAGCCCCGGCC d. TACAGACCTGCACCGTTC and CGAGCGGGTCGGGGCCGGarrow_forwardFor Pet41 (choose Pet41 a, b, or c as provided in the image) how would you design the primers (forward and reverse) for the following gene of interest and what restriction enzymes would be used (as shown in the image)? Be sure to explain and elaborate on why selected and how. Gene of Interest: atgggc gacaaaggga 241 cccgagtgtt caagaaggcc agtccaaatg gaaagctcac cgtctacctg ggaaagcggg 301 actttgtgga ccacatcgac ctcgtggacc ctgtggatgg tgtggtcctg gtggatcctg 361 agtatctcaa agagcggaga gtctatgtga cgctgacctg cgccttccgc tatggccggg 421 aggacctgga tgtcctgggc ctgacctttc gcaaggacct gtttgtggcc aacgtacagt 481 cgttcccacc ggcccccgag gacaagaagc ccctgacgcg gctgcaggaa cgcctcatca 541 agaagctggg cgagcacgct taccctttca cctttgagat ccctccaaac cttccatgtt 601 ctgtgacact gcagccgggg cccgaagaca cggggaaggc ttgcggtgtg gactatgaag 661 tcaaagcctt ctgcgcggag aatttggagg agaagatcca caagcggaat tctgtgcgtc 721 tggtcatccg gaaggttcag tatgccccag agaggcctgg cccccagccc acagccgaga 781 ccaccaggca gttcctcatg tcggacaagc ccttgcacct…arrow_forwardIs each of the following mutations a silent, missense, nonsense, orframeshift mutation? The original DNA strand is 5′–ATGGGACTAGATACC–3′. (Note: Only the coding strand is shown; the firstcodon is methionine.)A. 5′–ATGGGTCTAGATACC–3′B. 5′–ATGCGACTAGATACC–3′C. 5′–ATGGGACTAGTTACC–3′D. 5′–ATGGGACTAAGATACC–3′arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY