Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 7, Problem 23P
In human DNA, 70% of cytosine residues that are followed by guanine (so-called CpG dinucleotides, where p indicates the phosphate in the phosphodiester bond between these two
| a. | Methylated CpG dinucleotides are hotspots for point mutations in human DNA. Can you propose a hypothesis that explains why? | Making the simplifying assumptions that human DNA has an equal number of C–G and A–T base pairs, and that the human DNA sequence is random, how frequently in the human genome would you expect to find the base sequence CpG? |
| c. | It turns out that, even after taking into account the actual GC content of human DNA (˜42%), the frequency of CpG in human DNA is much lower than predicted by the calculation in part (b). Explain why this might be the case. | |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the following sequence, a cytosine was deaminated and is now a uracil (underlined).
5’-GGTAUTAAGC-3’
a. Which repair pathway(s) could restore this uracil to cytosine?
b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s).
c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b?
d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
The base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes tautomerization from its keto form to its enol form than does thymine. 5BU can be incorporated into newly synthesized DNA when it pairs with adenine on the template strand. However, the enol form of 5BU pairs with guanine rather than adenine. (a) Draw the 5BU · G base pair. (b) What type of mutation results?
In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence
3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5'
What is the sequence for the partner strand?
Chapter 7 Solutions
Genetics: From Genes to Genomes
Ch. 7 - The following is a list of mutational changes. For...Ch. 7 - What explanations can account for the following...Ch. 7 - The DNA sequence of one strand of a gene from...Ch. 7 - Among mammals, measurements of the rate of...Ch. 7 - Over a period of several years, a large hospital...Ch. 7 - Suppose you wanted to study genes controlling the...Ch. 7 - In a genetics lab, Kim and Maria infected a sample...Ch. 7 - The results of the fluctuation test Fig. 7.5 were...Ch. 7 - The following pedigree shows the inheritance of a...Ch. 7 - Autism is a neurological disorder thought to be...
Ch. 7 - Like the yellow Labrador retrievers featured in...Ch. 7 - Remember that Balancer chromosomes prevent the...Ch. 7 - Figure 7.14 shows examples of base substitutions...Ch. 7 - Figure 7.14a shows the mutagen 5-bromouracil 5-BU,...Ch. 7 - So-called two-way mutagens can induce both a...Ch. 7 - In 1967, J. B. Jenkins treated wild-type male...Ch. 7 - When a particular mutagen identified by the Ames...Ch. 7 - Prob. 18PCh. 7 - The Ames test uses the reversion rate His- to His...Ch. 7 - The mutant FMR-1 allele that causes fragile X...Ch. 7 - The physicist Stephen Hawking, famous for his...Ch. 7 - Aflatoxin B1 is a highly mutagenic and...Ch. 7 - In human DNA, 70 of cytosine residues that are...Ch. 7 - Bromodeoxyuridine BrdU is a synthetic nucleoside...Ch. 7 - Albinism in animals is caused by recessive...Ch. 7 - a. In Figure 7.22b, what can you say about the...Ch. 7 - Imagine that you caught a female albino mouse in...Ch. 7 - Plant breeders studying genes influencing leaf...Ch. 7 - In humans, albinism is normally inherited in an...Ch. 7 - a. Seymour Benzers fine structure analysis of the...Ch. 7 - a. You have a test tube containing 5 ml of a...Ch. 7 - Prob. 32PCh. 7 - The rosy ry gene of Drosophila encodes an enzyme...Ch. 7 - Nine rII- mutants of bacteriophage T4 were used in...Ch. 7 - In a haploid yeast strain, eight recessive...Ch. 7 - In Problem 24, you learned that Bloom syndrome is...Ch. 7 - The pathway for arginine biosynthesis in...Ch. 7 - In corn snakes, the wild-type color is brown. One...Ch. 7 - In a certain species of flowering plants with a...Ch. 7 - The intermediates A, B, C, D, E, and F all occur...Ch. 7 - In each of the following cross schemes, two...Ch. 7 - Prob. 42PCh. 7 - The following complementing E. coli mutants were...Ch. 7 - In 1952, an article in the British Medical Journal...Ch. 7 - Mutations in an autosomal gene in humans cause a...Ch. 7 - Antibodies were made that recognize six proteins...Ch. 7 - Prob. 47PCh. 7 - Prob. 48PCh. 7 - In addition to the predominant adult hemoglobin,...Ch. 7 - Most mammals, including New World primates such as...Ch. 7 - Humans are normally trichromats; we have three...
Additional Science Textbook Solutions
Find more solutions based on key concepts
What are the cervical and lumbar enlargements?
Principles of Anatomy and Physiology
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction
Which of the following would be used to identify an unknown bacterial culture that came from a patient in the i...
Microbiology Fundamentals: A Clinical Approach
a. What three lineages of lobe-fins survive today? b. Go back to the phylogenetic tree in Interactive Question ...
Study Guide for Campbell Biology
Sea turtles have disappeared from many regions, and one way of trying to save them is to reintroduce them to ar...
Marine Biology (Botany, Zoology, Ecology and Evolution)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?arrow_forwardThe chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forwardOf the four DNA bases, why is guanine most likely to be modified after exposure to polycyclic hydrocarbons such as benzo(a)pyrene, as shown in Figure 23.8? (Hint: Consider the pKa values of the four DNA bases.)arrow_forward
- In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?arrow_forwardAssume that a DNA sequencing reaction is carried out, except that the four different dideoxyribonucleoside triphosphates are modified so that each contains a covalently attached dye of a different color (which does not interfere with its incorporation into the DNA chain). What would the products be if you added a mixture of all four of these labeled dideoxyribonucleoside triphosphates along with the four unlabeled deoxyribonucleoside triphosphates into a single sequencing reaction? What would the results look like if you electrophoresed these products in a single lane of a gel?arrow_forward
- In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'arrow_forwardThe D1S80 locus is located on human chromosome 1 and is characterized by a repeating 16 base pair (bp) sequence. Alleles for this locus vary depending on the number of repeats present, thus affecting the size of the locus. The D1S80 locus also contains two conserved sequences, a 32bp sequence at one end and a 113bp sequence at the other end. If the DNA of an individual is targeted for D1S80 amplification, and one of the resulting amplicons is approximately 785bp in size, how many repeats would be present in this D1S80 allele? The amplicon of interest is indicated by a red arrow in the diagram below.arrow_forwardA diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many nucleosomes are present in such a cell? (Assume that the linker DNA encompasses 40 bp.) b. How many histone proteins are complexed with this DNA?arrow_forward
- in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardBelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?arrow_forwardGiven the partial transposons DNA sequence 5’-ACCGTATTCGGT-3’ upstream from the central region, assuming both terminal inverted repeats and flanking direct repeats have 6 base pairs, hypothetically write the transposon structure downstream from the central region.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY