Concept explainers
The physicist Stephen Hawking, famous for his theories about black holes, has lived past the age of 70 with amyotrophic lateral sclerosis (ALS), a paralyzing neurodegenerative disease that is usually fatal at a much younger age. Recently, geneticists discovered that a major cause of ALS is the unusual expansion of a hexanucleotide repeat (5′-GGGGCC-3′) that lies within a gene called C9ORF72, at a location outside of the gene’s open reading frame (ORF). A single expanded allele is sufficient to cause ALS, but the reason the disease allele is dominant remains unclear. Some experimental results support the theory that the allele makes a toxic RNA containing the expanded repeat. If this theory is correct, in what ways is the mutant ALS-causing allele similar to the mutant allele that causes Huntington disease? In what ways is it similar to the mutant allele that causes fragile X syndrome?
Want to see the full answer?
Check out a sample textbook solutionChapter 7 Solutions
Genetics: From Genes to Genomes
- In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3’-TACCACHTGGACTGAGGACTCCTCTTCAGA-5' What is the sequence for the partner strand?arrow_forwardA normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?arrow_forwardThe human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forward
- In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.arrow_forwardWhat will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)arrow_forwardA hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′What topic in genetics does this question address?arrow_forward
- In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotide in the amino acid coding region is represented by the sequence 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'arrow_forwardGeneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can hybridize one of the strands of that gene to the mRNA for that gene by allowing the strands to hydrogen bond. Why did the appearance of these hybridized strands provide evidence of the existence of introns in eukaryotic genes?arrow_forwardThe DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen genearrow_forward
- You learned in Problem 21 in Chapter 7 that theneurodegenerative disease ALS can be caused by expansion of a hexanucleotide repeat region (5′-GGGGCC-3′)outside of the open reading frame (but within the firstintron) of the gene called C9ORF72. While a normalC9ORF72 allele has 2–23 copies of the hexanucleotiderepeat unit, dominant disease-causing alleles have hundreds or even thousands of copies. Researchers observed that the first intron of theC9ORF72 disease allele is transcribed not only fromthe normal template strand of DNA, but also from thenontemplate strand. Even more unusual, both types ofrepeat-region transcripts are translated in all six readingframes in an AUG-independent manner—a processcalled repeat-associated non-ATG translation, or RANtranslation. These discoveries led to the hypothesisthat the proteins made from the repeats mightcontribute to ALS.a. What polypeptides are made from the repeat-regiontranscripts?b. According to the RAN translation hypothesis, whyare…arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardIn the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region. 4C. In NOT more than 200 words, explain how eukaryotic RNA synthesized by RNA polymerase II is modified before leaving the nucleus?arrow_forward
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning