Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 12P
Draw a bacterial promoter and label its consensus sequences. How does this promoter differ from a eukaryotic promoter transcribed by RNA polymerase II? By RNA polymerase I? By RNA polymerase III?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which component of the bacterial RNA polymerase recognizes the promoter?
What is the meaning of the term consensus sequence? Give an example. Describe the locations of consensus sequences within bacterial promoters. What are their functions?
How can the bacteriophage T7 promoter be used to controlexpression of a eukaryotic gene in Escherichia coli?
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The consensus sequence for the –35 sequence of a bacterial promoter is 5′–TTGACA–3′. The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or decrease the rate of transcription?arrow_forwardWhat part of the E.coli RNA polymerase specifically binds to the -10 and -35 region of an E.coli promoter?arrow_forwardIn class, we examined the promoter region of the human beta-globin gene. Although there were some substitutions from the consensus sequence which of the below did we NOT find? A. A Transcription Start SiteB. A -10 boxC. A TATA boxD. A CAAT boxarrow_forward
- Does RNA polymerase binds tightly to promoter DNA?arrow_forwardWhat is the relationship among core promoter elements, basal transcription factors, and RNA polymerase II in eukaryotes?arrow_forwardWhich of the following processes is required for the initiation of transcription in bacteria? Select one: a. binding of sigma to the promoter region b. formation of a peptide bond in the elongating polypeptide chain c. formation of a phosphodiester bond in the elongating RNA strand d. binding of DNA polymerase to the promoter regionarrow_forward
- Microbiologists describe the processes of transcription and translation as “coupled” in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. How is coupling possible in bacteria? Is coupling of transcription and translation possible in single-celled eukaryotes, such as yeast? Why or why not?arrow_forwardWhich protein subunit specifically binds to the promoter region in prokaryotic cells? α β ω β' σarrow_forwardwhat is the role of rna polymerase? Does it catalyzes the polymerization step (adding new nucleotide to rna) in transcription?arrow_forward
- Describe the promoter structure in prokaryotes and eukaryotes.arrow_forwardWhat is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5′–GGCAUGCAUUACGGCAUCACACUAGGGAUC–3′ What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5′ or 3′) of the template strand is the promoter located?arrow_forwardWhy is an NFR needed at the core promoter for transcription to occur?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license