Concept explainers
Wild-type E. coli grow best at
a.
b.
c.
d. What term best characterizes the type of mutation exhibited by the mutant bacterial strain? (Hint: The term was used in Chapter
Want to see the full answer?
Check out a sample textbook solutionChapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- How long would it take for the E. coli RNA polymerase to synthesize the primary transcript for the E. coli genes encoding the enzymes for lactose metabolism, the 5,300 bp5,300 bp lac operon? Assume an average elongation rate of 7070 nucleotides per second. a)How far along the DNA would the transcription "bubble" formed by RNA polymerase move in 10 seconds10 seconds? b)Assuming that human Pol II transcribes at a similar rate, how long does it take to transcribe the 2,000,000 bp2,000,000 bp dystrophin gene?arrow_forwardThe following nucleotide sequences are located about 30 nucleotides upstream of the transcription start site of 6 different organisms GAGAGC ААСТАС TACAAC ACGAAA TCCTAA TACAAC a. What is the consensus sequence of the promoter region?arrow_forwardThe following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?arrow_forward
- The most common type of termination signal in E. Coli is a symmetrical inverted repeat of GC rich sequences followed by about 7 As that forms a stable stem-loop structure in the RNA, which disrupts its association with the DNA template and terminates transcription. true or falsearrow_forwardShown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardThe consensus sequence for the –35 sequence of a bacterial promoter is 5′–TTGACA–3′. The –35 sequence of a particular bacterial gene is 5′– TTAACA–3′. A mutation changes the fifth base from a C to a G. Would you expect this mutation to increase or decrease the rate of transcription?arrow_forward
- A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C. a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C. b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?arrow_forwardWhich of the following general transcription factors are indicated as "minimally required" for transcription initiation in the Zhao paper? Select all that apply. TFIID TFIIB TFIIE TFIIA TFIIC TFIIF TFIIG TFIIHarrow_forwardDifferent sensitivities to the mushroom toxin a-amanitin distinguish the three RNA polymerases from one another. Which of the following properties listed below also distinguish RNA Polymerase II from Pol I and Pol III? Options: Only RNA Pol II possesses a large subunit RNA Polymerase I and RNA Polymerase III do not require TBP for optimal transcription efficiency only RNA Polymerase II requires an ATP-dependent helicase to melt the DNA around the transcription start site Only RNA Polymerase II resembles the prokaryotic RNA Polymerase RNA Pol II has an extended N terminal region that becomes phosphorylated during intiationarrow_forward
- The DNA sequence of the promoter region of E. coli xyzA gene is shown below. Transcription start site is the A (in bold) at position 43. 5 10 15 20 25 30 35 40 45 50 GAGCT GTTGA CAATT AATCA TCGAA CTAGT TAACT AGTAC GCAAG TTCAC Mutations were introduced in the sequence to identify residues important for gene expression. Indicate the effect of the following mutations on xyzA expression (increase, decrease, no effect, cannot be predicted). Provide reasoning for each answer. A. G3A (G at position 3 was changed to A) G9A Deletion of TCA at position 18-20 C22A T31A, A32T double mutant T35G G45C C48A B. What are the promoter sequences of the gene?arrow_forwardWhat experimental results would indicate that the mutation lacISlacIS is dominant to lacI+lacI+? In lacISlacIS/lacI+lacI+ partial diploids, the lac operon is in a repressed state in the absence of lactose. In lacISlacIS/lacI+lacI+ partial diploids, the lac operon is in a constitutive state in the absence of the repressor. In lacISlacIS/lacI+lacI+ partial diploids, the lac operon is in an activated state in the presence of lactose. In lacISlacIS/lacI+lacI+ partial diploids, the lac operon is in a repressed state in the absence of the repressor. In lacISlacIS/lacI+lacI+ partial diploids, the lac operon is in a repressed state in the presence of lactose.arrow_forwardSeveral examples of antisense RNA regulating translation in bacterial cells have been discovered. Molecular geneticists have also used antisense RNA to artificially control transcription in both bacterial and eukaryotic genes. If you wanted to inhibit the transcription of a bacterial gene with antisense RNA, what sequences might the antisense RNA contain?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education