Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 19P
A
a. What length of DNA is bound by the transcriptional proteins? Explain how the gel results support this interpretation.
b. Draw a diagram of this DNA fragment bound by the transcriptional proteins, showing the approximate position of proteins along the fragment. Use the illustration style seen in Research Technique
c. Explain the role of DNase I.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
A purified recombinant protein is analyzed for molecular weight by SDS-PAGE at pH 8.5. From the protein sequence deduced from the gene that was expressed in bacteria, the protein is expected to have a molecular weight of 44,000. However, the molecular weight of the protein is found by SDS-PAGE to be 52,000. Explain the reason or reasons for this difference in molecular weight. What calculation could you make to help explain this discrepancy?
A 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated.
Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA?
a.
250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb
b.
2.0kb
c.
250 bp, 400 bp, 450 bp, 500 bp and 550 bp
d.
100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bp
Chapter 8 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A linear piece of DNA that is 14 kb long is cut first by EcoRI alone, then by SmaI alone, and finally, by both EcoRI and SmaI together. The following results are obtained: Draw a map of the EcoRI and SmaI restriction sites on this 14-kb piece of DNA, indicating the relative positions of the restriction sites and the distances between them.arrow_forwardYou are engineering a new vector that contains a screenable marker that can be used for blue/white screening of successful clones. For each site (1, 2, and 3) on the cloning vector below, describe why it would or would not be a good place for you to put the polylinker to facilitate blue/white screening. You can assume that the polylinker itself will not interfere with coding sequence in that region. In other words, the polylinker length will be a multiple of 3 nucleotides, will not contain a stop codon, and any amino acids translated will not affect the activity of the protein in that region. The arrows indicate the direction of transcription for the gene.arrow_forwardYou are engineering a new vector that contains a screenable marker that can be used for blue/white screening of successful clones. For each site (1, 2, and 3) on the cloning vector below, describe why it would or would not be a good place for you to put the polylinker to facilitate blue/white screening. You can assume that the polylinker itself will not interfere with coding sequence in that region. In other words, the polylinker length will be a multiple of 3 nucleotides, will not contain a stop codon, and any amino acids translated will not affect the activity of the protein in that region. The arrows indicate the direction of transcription for the gene. Note from student:As stated in the problem... "YOU CAN ASSUME THAT THE POLYLINKER ITSELF WILL NOT INTERFERE WITH CODING SEQUENCE IN THAT REGION. IN OTHER WORDS, THE POLYLINKER LENGTH WILL BE A MULTIPLE OF 3 NUCLEOTIDES, WILL NOT CONTAIN A STOP CODON, AND ANY AMINO ACIDS TRANSLATED WILL NOT AFFECT THE ACTIVITY OF THE PROTEIN IN THAT…arrow_forward
- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possiblearrow_forwardKnowing that you are using HindIII and EcoRI to cut your plasmids, and that those two enzymes cut within the MCS, use the map of pUC19 provided below to compute: What will be the sizes of the 2 restriction fragments if NO insert is present in pUC19? What will be the sizes of the 2 restriction fragments if the approximately 317 bp RT-PCR product (insert from WT satC dimer) was ligated successfully into the SmaI site? What will be the sizes of the 2 restriction fragments if TWO approximately 317 bp RT-PCR products (2 ligated inserts from WT satC dimer) were ligated into the SmaI site?arrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forward
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forwardA linear piece of DNA that is 30 kb long is first cut with BamHI, then with HpaII, and, finally, with both BamHI and HpaII together. Fragments of the following sizes were obtained from this reaction: BamHI: 20-kb, 6-kb, and 4-kb fragments Hpall: 21-kb and 9-kb fragments BamHI and Hpall: 20-kb, 5-kb, 4-kb, and 1-kb fragments Draw a restriction map of the 30-kb piece of DNA, indicating the locations of the BamHI and HpaII restriction sitesarrow_forwardIn reversible terminator sequencing, how would the sequencing process be affected if the 3′-end-blocking group of each nucleotide were replaced with the 3′-H present in the dideoxynucleotides used in Sanger sequencing?arrow_forward
- You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…arrow_forwardIn the Avery, McLeod, McCarty Experiment where supernatant from heat killed, virulent S Strain pneumonia solutions were added to non-virulent R Strain pneumonia cell cultures and allowed to grow in liquid media (i.e., broth). In tubes where DNAase was added to the supernatant prior to cell culture, what was the observed effect when plating and growing the S. pneumonia cells to solid media? a All RNA was degraded and Transformation of the R Strain to S Strain occurred. b All Protein was degraded and Transformation of the R Strain to S Strain occurred. c All DNA was degraded and Transformation of the R Strain to S Strain did not occur. d All RNA was degraded and no Transformation occurred indicating RNA is the molecule of Transformation inheritance e None of the above are truearrow_forwardThat's the result of Gel electrophoresis of genomic DNA ( Of genomic DNA extraction experiment), please discuss the results and label and name the image to illustrate the answer? - Marker band sizes in gel: From top (well side) to bottom the bands have the following size in base-pair/bp- 6751,3652,2827,1568,1118,825,630arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License