Microbiology: An Introduction
12th Edition
ISBN: 9780321929150
Author: Gerard J. Tortora, Berdell R. Funke, Christine L. Case
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 2A
Replication of the E. coli chromosome takes 40 to 45 minutes, but the organism has a generation time of 26 minutes. How does the cell have time to make complete chromosomes for each offspring cell?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Does E. coli chromosomal replication always start at one particular site? What is called?
If you were given the DNA sequence of E. coli chromosome, would you be able to identify where E. coli chromosomal replication starts?
What is the end of E. coli chromosome replication?
If a bacterial (E. coli) cell has 50,000 bp, how long will be a normal DNA replication?
Is the DNA chromosomes replication of prokaryotic cells: bidirectional, semi-conservative, and completely continues?
Chapter 8 Solutions
Microbiology: An Introduction
Ch. 8 - Briefly describe the components of DNA, and...Ch. 8 - DRAW IT Identify and mark each of the following on...Ch. 8 - Match the following examples of mutagens. Column A...Ch. 8 - The following is a code for a strand of DNA. a....Ch. 8 - Identify when (before transcription, after...Ch. 8 - Which sequence is the best target for damage by UV...Ch. 8 - You are provided with cultures with the following...Ch. 8 - Why are mutation and recombination important in...Ch. 8 - NAME IT Normally a commensal in the human...Ch. 8 - Match the following terms to the definitions in...
Ch. 8 - Match the following terms to the definitions in...Ch. 8 - Feedback inhibition differs from repression...Ch. 8 - Bacteria can acquire antibiotic resistance by all...Ch. 8 - Suppose you inoculate three flasks of minimal...Ch. 8 - Plasmids differ from transposons in that plasmids...Ch. 8 - Mechanism by which the presence of glucose...Ch. 8 - The mechanism by which lactose controls the lac...Ch. 8 - Two offspring cells are most likely to inherit...Ch. 8 - Which of the following is not a method of...Ch. 8 - Nucleoside analogs and ionizing radiation are used...Ch. 8 - Replication of the E. coli chromosome takes 40 to...Ch. 8 - Pseudomonas has a plasmid containing the mer...Ch. 8 - Ciprofloxacin, erythromycin, and acyclovir are...Ch. 8 - HIV, the virus that causes AIDS, was isolated from...Ch. 8 - Human herpesvirus-8 (HHV-8) is common in parts of...
Additional Science Textbook Solutions
Find more solutions based on key concepts
The pedigrees indicated here were obtained with three unrelated families whose members express the same disease...
Genetics: From Genes to Genomes
2. Define equilibrium population. Outline the conditions that must be met for a population to stay in genetic e...
Biology: Life on Earth (11th Edition)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
11. In the early 1800s, French naturalist Jean Baptiste Lamarck suggested that the best explanation for the rel...
Campbell Biology: Concepts & Connections (9th Edition)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardAs shown, telomerase attaches additional DNA, six nucleotides at a time, to the ends of eukaryotic chromosomes. However, it makes only one DNA strand. Describe how the opposite strand is replicated.arrow_forwardConsidering prokaryotes, what term adds nucleotides in the 5' to 3' direction during DNA replication?arrow_forward
- If all of the primase enzymes were removed from a cell, how would this affect the replication process?arrow_forwardMost prokaryotes have a circular chromosome, with no ends, so the shortening of DNA does not occur. But what protects the genes of linear eukaryotic chromosomes from being eroded away during successive rounds of DNA replication?arrow_forwardHow fast does template DNA spin (expressed in revolutions per second) at an E. coli replication fork?arrow_forward
- Describe in order, the four repeating steps that repeat over and over on the discontinuous lagging strand of DNA replication and name the major proteins required to carry out each of these steps in E. coli The first function is given. I. Function: Create RNA primer Enzyme: II. Function: Enzyme: III. Function: Enzyme: IV. Function: Enzymearrow_forwardIf a eukaryotic chromosome has 25 origins of replication, how many replication forks does it have at the beginning of DNA replication?arrow_forwardIn eukaryotes, the DNA replication rate is 50 nucleotides per second. How long would the replication of a chromosome of 150 million base pairs take if eukaryotic chromosomes were replicated like those of prokaryotes? Actually, eukaryotic replication takes only several hours. How do eukaryotes achieve this high rate?arrow_forward
- What is the end replication problem?arrow_forwardWhich of the following enzymes can break, and rejoin, phosphodiester bonds during the normal DNA replication process in the chromosomes of E. coli cells? single-stranded binding proteins RNA polymerase topoisomerase DNA helicase DNA ligasearrow_forwardTrue or false: After chromosomal replication, Type I topoisomerase is used to coil up the double-stranded DNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license