Consider the following mRNA sequence of codons GUA AGAAGCGC a. Deduce the corresponding sequence of amino acids b. Deduce the corresponding sequence of genes that would be found on the originating chromosome.

Consider the following mRNA sequence of codons GUA AGAAGCGC a. Deduce the corresponding sequence of amino acids b. Deduce the corresponding sequence of genes that would be found on the originating chromosome.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Related questions

Q: Compare the two mRNA sequences below. AUAUUCGGCAAUCCG AUAUUCCGCAAUCCG This change could be the…

A: Messenger RNA or mRNA is single stranded RNA which acts as template for the synthesis of amino acids…

Q: Which of the following terms is used for the various forms of any one a) Autosomes b ) Codons c)…

A: Genes have a variety of different forms which are located at the same position or can be called…

Q: Refer to the Table of the Genetic Code and match the type of mutation to the following codon changes

A: Mutation : A mutation is defined as the changes in the nucleotide sequence. These results in…

Q: Tell whether the following elements are found on DNA or RNA: a. -10 region b)e. poly(A) tai c).…

A: a) -10 region is found in DNA. it is also called pribnow box and is an essential part of a promoter…

Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌also‌ ‌contains‌ ‌genetic‌ ‌material‌ ‌but‌ ‌rarely‌ ‌takes‌ ‌part‌…

Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…

A: Central dogma is the process where in the information stored in nucleic acids is transferred to…

Q: During transcription, how many RNA nucleotide bases would usually be encoded by a sequence of 99 DNA…

A: Transcription is the first step of making a protein from DNA instructions. The human genome is made…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the DNA acts as genetic material and transcripted…

Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…

A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: With the help of the Human Genome Project, it has now become possible to sequence all of the genes…

Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…

A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…

Q: The gel below is the result of a Sanger sequencing run of part of Exon 3 of the Mstn gene, which…

A: In Sanger sequencing, the objective is to analyze the sequence of a given strand of DNA. To obtain…

Q: Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: According to Bartleby guidelines only the first question in case of multiple questions have to be…

Q: The template strand of a gene has the sequence 5'- CTACCGCGCGGTGCTAGGGGCCAT-3' What is the third…

Q: Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by…

A: Transcription is the process by which the information contained in DNA is converted into a…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: A desired gene is defined as the insertion of copies of the gene into the living cells in order to…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…

A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…

Q: Identify which regions of DNA encode the protein sequence. Consider that there may be introns (which…

A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…

Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. If…

A: Transcription can be defined as the process in which RNA is formed from the DNA. It is the initial…

Q: There are 3 RNA polymerases in eukaryotes. Write a sentence about the function of each. Which is…

A: RNA polymerase enzyme synthesizes RNA from template of DNA.

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: Consider the following gene with their respective introns and exons 5’ –…

A: Since you have asked multiple questions, we will solve the first three question for you. If you want…

Q: Write the sequences of bases in the sense strand of DNA that resulted in the mRNA in Problem .

A: DNA is a double helical molecule, in which two complementary strands are held together with the help…

Q: A.Give the transcript that will be formed from this template. 3- TACGGGTTATATTCAATC-5" B.Give the…

A: The DNA is copied into RNA (transcript) by a process called transcription. It takes place inside the…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the processed mRNA transcript…

A: Gene is the sequence of nucleotide that encode a particular amino acid. It is found in DNA.

Q: Define the following terms: a. open reading frame b. degenerate coding system c. nonoverlapping…

A: Note: Since you have posted a question with multiple subparts, we will solve the first three…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA…

A: Gene expression is the process by which the instructions in our DNA are converted into a functional…

Q: Use the DNA sequence above, list all possible splicing products

A: Splicing, is a form of RNA processing in which a pre- mRNA transcript is transformed into a mRNA.…

Q: Need help to answer the following questions. Not sure if my answers are right.

A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…

Q: Given the following DNA sequence from the template strand of a given gene:…

A: Codon is a sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA…

Q: D. Which letter in the diagram above best corresponds to the location where exons are found? O A O C…

A: The method of producing RNA copies of a genetic sequence is known as transcription. This duplicate,…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…

Q: Given the following coding strand of DNA: 3' – TACCGAGTACTGACT – 5', the mRNA that will transcribed…

A: The method of constructing an RNA copy of a genetic sequence is known as transcription. The copy,…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Below is the double stranded DNA sequence of part of a hypothetical yeast genome encoding a very…

A: Introduction Transcription : It Is The Initial Stage In Gene Expression, Which Involves "The…

Q: Which of the following would be present in a genome but not the transcriptome? (Select all) A)…

A: A transcriptome is the complete range of messenger RNA, or mRNA, molecules displayed by an organism.…

Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…

A: The given DNA sequence is as follows, TGC GTG TAC CTA CCA

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…

A: The mRNA is produced by the process of transcription.

Q: a) Examine the nudeotide sequence below, and determine the amino acid sequence encoded by this mRNA.…

A: a) The nucleotide and translated mRNA and amino acid sequences are given below: GGA GGC CTG GCC TAC…

Q: b. Explain how Nirenberg and Leder/Matthaei were able to create many of the codon/amino acids found…

A: Nirenberg and P. Leder developed a triplet binding assay in 1964. It was an historically important…

Q: Define the following terms: a. histone b. heterochromatin c. spermine d. intergenic sequences e.…

A: DNA is packaged into the cell nucleus after packaging into nucleosomes. The DNA contains regions of…

Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…

A: AAG ATA CAG GCT CGG TAA : DNA

Q: a. How can a single eukaryotic gene give rise to several different types of mRNA molecules?b.…

A: The process of synthesis of mRNA from DNA is called transcription. This process takes place with the…

Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…

A: Transcription is a process through which the double stranded DNA transcribes itself into a single…

Q: a molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: As given in the question, there is a particular gene in the human liver cells that quotes for an…

Question

Please show all steps

Consider the following mRNA sequence of codons
GUA AGAAGCGC
a. Deduce the corresponding sequence of amino acids
b. Deduce the corresponding sequence of genes that would be found on the originating
chromosome.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

Step 2

Step 3

Step 4

Trending now

This is a popular solution!

Step by step

Solved in 4 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Figure 28.41 gives some examples of recombination in IgG codons 95 and 96, as specified by the Vkand Jkgenes. List the codon possibilities and the amino acids encoded if recombination occurred in codon 97. Which of these possibilities is less desirable?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
State the DNA sequence that encodes the anticodon that recognizes the codon AAG, with 5’ and 3’ ends labeled.
Translate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'
Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
For the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCC
Refer to the DNA sequence provided:3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNAin (a)? (The question for A is this: What is the mRNA transcript of the anticoding strand of the DNA model?)
Refer to the genetic code in Figure 15.10 to answer the following question Q. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?
GIVEN THE FOLLOWING DNA SEQUENCES (+) OF THE GENBANK: INDICATE WHICH IS THE TEMPLATE MOLECULE, WHICH IS THE mRNA AND THE POLYPEPTIDE THAT IS FORMED FROM THE SEQUENCE DNA 5' atgagtaaagga 3'
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?
Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?