GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 19P
The double
Identify which of the following molecular probes is the best choice for achieving the desired hybridization reaction. Indicate where on the upper or lower strand the probe will hybridize.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Sequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which picture shows the correct 4 reactions after separation of the sequencing reaction by gel
electrophoresis?
Template:
Primer:
5'-ATCGCTTACCATTAG-3'
5'-CTAAT-3'
ddA ddC ddG ddT
ddA
ddC ddG ddT
=
D
ddA ddC ddG ddT
A
ddA ddC ddG ddT
—
B
C
A sample of DNA with the sequence
5'- CTC GAG CGA AGC TCA ACC-3'
he was obtained as a dry solid. The sample was dissolved in 1000 µl of deionized water ane
mixed well. Ten microliters of the dissolved sample was then transferred to a new sampie
tube and mixed with 990 ul of water, The dilute sample had A260 = 0.156. What was the
concentration of the original sample (the solid dissolved in 1000 ul of deionized water)
Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA extraction practical?
Summary of Qiagen DNA extraction steps
Add ATL buffer and grind with sample. Add 20 microliters of enzyme Proteinase K to degrade protein into a 1.5-2ml microcentrifuge tube. Add 200 microlitres AL lysis buffer, and mix by vortexing for 5–10 seconds, which breaks cell membrane allowing DNA to be released. Incubate the sample at 56 degrees for 10 minutes. Mix the cell lysate with 200 microlitres ethanol by pipetting it at the side of the microcentrifuge wall so DNA precipitates. The DNA forms a white layer and the remaining liquid is discarded. Pipet the mixture into DNeasy Mini spin column placed in a 2 ml collection tube. Centrifuge for a minute at 8000 rpm. Place the mini spin column into a 2 ml collection tube, add 500 µl Buffer AW1, and centrifuge for 1 min at 8000 rpm. Then add it to a new 2 ml collection tube (provided), add 500 µl Buffer AW1, and centrifuge for 1…
Chapter 10 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 10 - Define the following terms as described in this...Ch. 10 - 2. Using sickle cell disease as an example,...Ch. 10 -
3. Compare and contrast the contributions of...Ch. 10 - Why do differences in protein electrophoretic...Ch. 10 - Prob. 5PCh. 10 - Prob. 6PCh. 10 - Prob. 7PCh. 10 - 8. Wildtype βglobin protein is composed of amino...Ch. 10 - Prob. 9PCh. 10 - Prob. 10P
Ch. 10 - 11. How is an autoradiograph produced from a...Ch. 10 - Prob. 12PCh. 10 - Prob. 13PCh. 10 - Prob. 14PCh. 10 - The family represented in the pedigree and...Ch. 10 - Suppose the mating couple (I-1 and I-2) shown in...Ch. 10 - What are restriction endonucleases, and why are...Ch. 10 - 18. Following restriction digestion, DNA fragments...Ch. 10 - 19. The doublestranded DNA sequence below is part...Ch. 10 - 20. Restriction enzymes recognize specific...Ch. 10 - Prob. 21PCh. 10 - Prob. 22PCh. 10 - Prob. 23PCh. 10 - Prob. 24PCh. 10 - 25. A second strain of dwarf plants has a...Ch. 10 - During gel electrophoresis of linear DNA...Ch. 10 - Prob. 27PCh. 10 - 28. In molecular biology, restriction...Ch. 10 - A complete plant gene containing four introns and...Ch. 10 - Prob. 30PCh. 10 - The map below illustrates three alleles in a...Ch. 10 - Prob. 32PCh. 10 - 33. Northern blot analysis is performed on mRNA...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The transformation results below were obtained with 10 ul of intact plasmid DNA at nine concentrations. The following numbers of colonies are obtained when 100 ul of transformed cells are plated on selective medium: Fill in the following table: Concentration # colonies DNA mass of Fraction of Mass Transformation PGREEN (Concentration x volume OR X spread = x 10ul plasmid solution) PGREEN in cell Cell efficiency Y÷ A suspension suspension spread = 100 ul - total vol cell susp. (Colonies - Mass spread) C x Z = A See (510 ul) HINT: this calculation is constant Given= X Given=Y С. Z. 0.00001 ug/ul | 4 0.00005 ug/ul 12 0.0001 ug/ul 0.0005 ug/ul 32 125 0.001 ug/ul 442 0.005 µg/ul 0.01 ug/ul 0.05 ug/ul 0.1 ug/ul 542 507 475 516 0.5 ug/ul 505arrow_forwardYou will be setting up your diagnostic digest on three plasmids, the ones you began with, pGFPuv and PHSG298 and your presumptive pHSG298-GFP. Complete the table below: Solution Stock Working Volume for one reaction Volume for Master Mix (3.5X) Cutsmart buffer 10X 1X Restriction enzyme(s) 1 µl uL Water UL UL 2 µl 25 pL DNA Total volumearrow_forward1) Prepare the following enzymatic reaction, present it in tabulated form. In a final volume of 30 ul, where buffer 4 (10 ml). How much volume of each reagent would be used and how much of water? Is there any problem? 2) The DNA pol 1 enzyme comes at a concentration of 50,000 U/ml. You have to prepare a 50 ug PCR reaction where you must use 0.05 U/ml reaction. You add 10 ul of PCR buffer, 2 ng of tempered DNA that is at a concentration of 0.5 ng/ul, primers (which are at 200 mM) so that each one remains at a concentration of 200 uM, Mg+2 that is 5 mM (10 X), enzyme and water. Present the table of all the reagents included in the reaction, the volumes of each one in ul. Present where the initial and final concentration of each reagent applies. Assume you have micropipettes for all values.arrow_forward
- For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’arrow_forwardYou digest 4 uL of plasmid DNA that is 50 ng/uL concetration in a total volume of 20 uL. You run 10 uL of the digest on teh gel. You then do a DNA purification protocol with a Zippy prep on the remaining digested DNA. You elute the DNA in a 25 uL. A 2 uL ssample has the concentration of 2 ng/uL. What is the DNA yield?arrow_forwardFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forward
- Coding With the given coding strand perform the following 1. supply the correct non- coding strand 2. Identify the location of following restriction enzyme by enderlining it in the coding strands 3. Supply the correct non-coding strands for the two restriction enzymes EcoRi - 5' GAATTC 3'BamH1 - 5' GGATTC 3' 5' ATGCATGGTACGTAGAGTTCCATGAATTCGCCCCTATAGGGTAGCCGAGGATTCTATGCCCGAATGTC 3'arrow_forwardSequencing reactions are done in separate tubes for each ddNTP with a radioactive primer. Which picture shows the correct 4 reactions after separation of the sequencing reaction by gel electrophoresis? (Hint: Primer sequence cannot be read from the gel.) Template: Primer: 5'-ATCGCTTACCATTAG-3' 5'-CTAAT-3' ddA ddC ddG ddT ddA ddC ddG ddT = — ddA ddC ddG ddT = A B O None of these figures A ddA ddC ddG ddT B C Darrow_forwardAll ingredients required for the synthesis of DNA were placed in a test tube. The primer has the sequence 5’-TCGATCA-3’. First determine where the primer will bind to the DNA template given below (Do this by writing the sequence of the primer on top of the template – make sure you find a location that is complementary in sequence and that the primer is antiparallel with respect to the template) and then indicate the nucleotides that DNA polymerase would attach onto the primer as it synthesizes DNA (hint: in which direction does DNA polymerase attach nucleotides onto a primer?) See figure 13.16 in book. 5’-GACGTAGTCTGATGCTAGCATGCTGATCGAAAGAG-3’arrow_forward
- A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' What is the base sequence of the synthesized fragment? O 5'-AGTCGAAT-3' ddCTP O 5'-TAAGCTGA-3' I ddGTParrow_forwardYou are given the following DNA fragment to sequence:5'-GCTTAGCATC-3'. You first clone the fragment in bacterialcells to produce sufficient DNA for sequencing. You isolate theDNA from the bacterial cells and carry out the dideoxy-sequencingmethod. You then separate the products of the polymerizationreactions by gel electrophoresis. Draw the bands that shouldappear on the gel from the four sequencing reactions.arrow_forwardA piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP ddCTP ddGTP What is the base sequence of the original fragment that you were given? 5'-TAAGCTGA-3' O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' O 5'-AGTCGAAT-3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY