Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 5MCQ
Which of the following sequences, when combined with its complement, could be clipped by an endonuclease?
- a. ATCGATCGTAGCTAGC
- b. AAGCTTTTCGAA
- c. ACCATTGGTA
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Choose the combination of answers that most accurately completes the statement.Which of the following sequences, when combined with its complement, would be clipped by a restriction endonuclease? a. ATCGATCGTAGCTA c. GAATTC b. AAGCTTCGAA d. ACCATTGGA
Why would you NOT expect a restriction endonuclease to exist that would recognize the site AAGGAA?
Which proteins are responsible for the unwinding of the double-stranded DNA during relication?
A.
Primases.
B.
Lyases.
C.
Helicases
D.
Topoisomerases
E.
Ligases
Chapter 10 Solutions
Microbiology: A Systems Approach
Ch. 10.1 - Provide examples of practical applications of...Ch. 10.2 - Prob. 2AYPCh. 10.2 - Describe how gel electrophoresis is used to...Ch. 10.2 - Prob. 4AYPCh. 10.2 - Prob. 5AYPCh. 10.3 - Prob. 6AYPCh. 10.3 - List examples of genetically modified bacteria,...Ch. 10.4 - Prob. 8AYPCh. 10.4 - Prob. 9AYPCh. 10.5 - Outline in general terms the process of DNA...
Ch. 10.5 - Prob. 11AYPCh. 10.5 - Prob. 12AYPCh. 10.5 - Prob. 13AYPCh. 10.6 - Prob. 14AYPCh. 10 - Which of the following is/are not essential to...Ch. 10 - Prob. 2MCQCh. 10 - The function of ligase is to a. rejoin segments of...Ch. 10 - The creation of biological molecules entirely from...Ch. 10 - Which of the following sequences, when combined...Ch. 10 - A region of DNA in a plasmid that is recognized by...Ch. 10 - Prob. 7MCQCh. 10 - Which of the following is a primary participant in...Ch. 10 - Single nucleotide polymorphisms are found in a....Ch. 10 - Microarrays are used to monitor a. the rate of DNA...Ch. 10 - Prob. 11TFCh. 10 - A nucleic acid probe can be used to identify...Ch. 10 - Prob. 13TFCh. 10 - In order to detect recombinant cells, plasmids...Ch. 10 - Plasmids are the only vectors currently available...Ch. 10 - You are a public health official trying to...Ch. 10 - a.Construct a strand of complementary DNA (cDNA)...Ch. 10 - a.Explain whether or not DNA polymerase from a...Ch. 10 - a.Define the term RFLP. Explain how RFLPs are...Ch. 10 - Prob. 5CTQCh. 10 - From chapter 6, figure 6.19. What has happened to...Ch. 10 - Prob. 2VCCh. 10 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The enzyme that removes RNA primers attached by Primase is?arrow_forwardWhich of the following pairs of sequences might be found at the ends of an insertion sequence? a. 5′–GGGCCAATT–3′ and 5′–CCCGGTTAA–3′ b. 5′–AAACCCTTT–3′ and 5′–AAAGGGTTT–3′ c. 5′–TTTCGAC–3′ and 5′–CAGCTTT–3′ d. 5′–ACGTACG–3′ and 5′–CGTACGT–3′ e. 5′–GCCCCAT–3′ and 5′–GCCCAT–3′arrow_forwardDefine the following terms: a. processivity b. replisome c. exonuclease d. DNA ligase e. repliconarrow_forward
- A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA fragments? a. AGTCCGAAGTC c. GACTTCGGACT b. TCAGGCTTCAG d. UGAGGCUUGAGarrow_forwardWhich of the following sequences in double-stranded DNA ismost likely to be recognized as a cutting site for a restrictionenzyme?(A) AAGGTTCC(B) GGCCCCGG(C) ACCATGGT(D) AAAATTTTarrow_forwardA researcher has isolated a restriction endonuclease that cleaves at only one particular 10- basepair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain.arrow_forward
- Which of the following would restore a gene back to its proper reading frame? A. one insertion that contained 3 nucleotides B. three insertions that contained two nucleotides each C. one deletion of 2 nucleotides and one insertion of 3 nucleotides. D. two insertions that contained one nucleotide eacharrow_forwardThe following is part of the non-template strand of DNA for a gene. 5'-TACTATCATGAGAGATAGGAG-3' Which of these sequences corresponds to the mRNA after transcription A)5'-AUGAUAGUACUCUCUAUCCUC-3' B) 5'-TACTATCATGAGAGATAGGAG-3' c) 5'-ATGATAGTACTCTCTATCCTC-3' d) 5'-UACUAUCAUGAGAGAUAGGAG-3' E) N-Tyr-Tyr-His-Glu-Thr-Carrow_forwarda. Why do bacteria make restriction endonucleases? b. What is it about the endonucleases that prevents bacteria from destroying their own DNA?arrow_forward
- List the sequences of RNA that would be transcribed from the following DNA template sequences. TTACACTTGCTTGAGAGTC ACTTGGGCTATGCTCATTA GGCTGCAATAGCCGTAGAT GGAATACGTCTAGCTAGCAarrow_forwardA section of template DNA has the following sequence of nitrogenous bases: 5’-CGATTACTG-3’. Which of the following sequences would be produced as a result of transcription? Group of answer choices CGTUUTCAG CGAUUACUG GCUAAUGAC GCTAATGACarrow_forwardWhich of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY