Microbiology: A Systems Approach
5th Edition
ISBN: 9781259706615
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 2CTQ
a. Construct a strand of complementary DNA (cDNA) from the following mRNA transcript: 3′-UAUGAACCCCGCUUU-5′
b. What enzyme is used to copy DNA from an mRNA transcript, and why is it necessary to utilize this process to synthesize eukaryotic genes for use in bacterial cells?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
B. Using the DNA sequence above, write a new DNA sequence from 3’ to 5’ that incorporates a transition
leading to a silent mutation in the second amino acid. Bold or underline the nucleotide that has been
changed
-Write down the complementary DNA sequence.
TACCTAGCG CACATGTAGGTGGGCAAAGTT
-Write down the complementary mRNA sequence for each of the following DNA sequence.
A: TACCTAGCGCACATGTAGGTGGGCAAAGTT
B:
TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG
-If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence.
This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation
TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT
TAC CTA ACACACATGTAGGTGGGCAAAGTT
State whether the gene is up- or down-regulated and briefly explain the reason behind.
DNA lacks methylated cytosine residues.
Chapter 10 Solutions
Microbiology: A Systems Approach
Ch. 10.1 - Provide examples of practical applications of...Ch. 10.2 - Prob. 2AYPCh. 10.2 - Describe how gel electrophoresis is used to...Ch. 10.2 - Prob. 4AYPCh. 10.2 - Prob. 5AYPCh. 10.3 - Prob. 6AYPCh. 10.3 - List examples of genetically modified bacteria,...Ch. 10.4 - Prob. 8AYPCh. 10.4 - Prob. 9AYPCh. 10.5 - Outline in general terms the process of DNA...
Ch. 10.5 - Prob. 11AYPCh. 10.5 - Prob. 12AYPCh. 10.5 - Prob. 13AYPCh. 10.6 - Prob. 14AYPCh. 10 - Which of the following is/are not essential to...Ch. 10 - Prob. 2MCQCh. 10 - The function of ligase is to a. rejoin segments of...Ch. 10 - The creation of biological molecules entirely from...Ch. 10 - Which of the following sequences, when combined...Ch. 10 - A region of DNA in a plasmid that is recognized by...Ch. 10 - Prob. 7MCQCh. 10 - Which of the following is a primary participant in...Ch. 10 - Single nucleotide polymorphisms are found in a....Ch. 10 - Microarrays are used to monitor a. the rate of DNA...Ch. 10 - Prob. 11TFCh. 10 - A nucleic acid probe can be used to identify...Ch. 10 - Prob. 13TFCh. 10 - In order to detect recombinant cells, plasmids...Ch. 10 - Plasmids are the only vectors currently available...Ch. 10 - You are a public health official trying to...Ch. 10 - a.Construct a strand of complementary DNA (cDNA)...Ch. 10 - a.Explain whether or not DNA polymerase from a...Ch. 10 - a.Define the term RFLP. Explain how RFLPs are...Ch. 10 - Prob. 5CTQCh. 10 - From chapter 6, figure 6.19. What has happened to...Ch. 10 - Prob. 2VCCh. 10 - Using the words that follow, please create a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forwardRefer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?arrow_forwardExplain why it is sometimes difficult to locate genomic regions that encode a protein.arrow_forward
- a. What are all the transversions that can be made starting with the codon CGG?b. Which of these transversions will be missense? Can you be sure?arrow_forwardComplete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…arrow_forwardThe pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never madearrow_forward
- A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)arrow_forwardan adult with a history of tanning has his genome sequenced. The beginning of a protein coding region of his DNA reads ATGGGGATATGGCAT. If the protein coding region of a healthy adult reads ATGGGGATATGAGCAT identify the site and type of mutation. What might happen because of this mutationarrow_forwarda) Complete the table below. Assume that reading is from left to right and that the columns represent transcriptional and translational alignments. Label the 5’ and 3’ ends of DNA and RNA and carboxy and amino acid ends of protein. (You may fill in this chart by hand writing- no typing necessary here.) 2. b) Is the top or bottom DNA strand the template strand?arrow_forward
- 1. (a) What will be the newly synthesized DNA from the template given? DNA Template 3 - CGGATGCCCGTATAC -5 3 - GCCTACGGGCATATG -5 5 - GCCTACGGGCATAAG -3 5 - GCCTACGGGCATATG -3 3 - CGGATGCCCGTATAC -5 (b) Which is the DNA template given if the mRNA is 5 - CGGAUGCCCGUAUACGUA -3 ? 3 - GCCTACGGGCATATGGTA -5 5 - GCCTACGGGCATAAGGAT -3 5 - GCCTACGGGCATATGCAT -3 3 - CGGATGCCCGTATACCTA -5arrow_forwardConsider the following portion of mRNA produced by the normal order of DNA nucleotides: 5’ – CUU AAA CCA GUU – 3’ a. What is the template DNA sequence that was used to synthesize this portion of mRNA? b. What is the amino acid order produced from this mRNA? c. Write the amino acid sequence if a mutation changes CUU to CAU. Is this likely to affect protein function?arrow_forward2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation 5'TAA3' (which will be transcribed into 5'UAA3' in the mRNA - but recall that mutations are changes in the DNA sequence). Name all the amino acids that could have been coded for by the original, unmutated codon at that position in the gene.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY