BIOLOGY
12th Edition
ISBN: 9781260169614
Author: Raven
Publisher: RENT MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17, Problem 2S
Amyloid beta is a proteolytic product of a protein found in the brain called amyloid precursor protein (APP). At high concentrations, amyloid beta clumps together and may be a cause of Alzheimer disease. How might you go about studying, in a mouse model, whether particular mutations maintained the normal function of APP, while preventing clumping of the amyloid beta derived from APP?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The protein encoded by the cystic fibrosis gene is 1480amino acids long, yet the gene spans 250 kb. How is thisdifference possible?
A plant geneticist was examining the inversion mutation XI 501 in barley where a segment of DNA is removed, flipped, and reinserted in reverse order. The original protein functioned to assist in the separation of daughter cells during meiosis. A model of the initiation of normal protein translation is shown in the diagram. The action of the mutation is shown in orange.
Using the model, which of the following predicts how the XI 501 mutation affects the protein produced?
A - It creates a protein with the order of amino acids reversed, causing the protein to fold backward, reducing pollen functionality.
B - It creates a nonsense protein that does not function in the cell, causing the cell to use energy to remove the proteins, reducing pollen fertility.
C - It creates a protein that terminates at the mutation, causing the pollen to carry more than one copy of the genetic material in each granule.
D - It creates a protein with half the amino acids correct and half reversed, reducing…
The tumor suppressor pRB also binds to and suppresses the activity of retinoblastoma-binding protein 2 (RBP2), a histone demethylase that removes methyl groups from di- and trimethylated lysines in histone 3. What is the possible consequence of an inactivating mutation in RB1 that causes an inability of pRB to bind RBP2?
Chapter 17 Solutions
BIOLOGY
Ch. 17.1 - Prob. 1LOCh. 17.1 - Prob. 2LOCh. 17.1 - Describe the construction and uses of recombinant...Ch. 17.2 - Relate the process of DNA replication to PCR.Ch. 17.2 - Compare and contrast PCR, RT-PCR, and quantitative...Ch. 17.3 - Prob. 1LOCh. 17.3 - Prob. 2LOCh. 17.3 - Describe the pros and cons of RNA interference and...Ch. 17.4 - Explain how the universal nature of the genetic...Ch. 17.4 - Compare and contrast knockout, knockin, and...
Ch. 17.4 - Prob. 3LOCh. 17.5 - Describe the benefits of biofuel production from...Ch. 17.5 - Prob. 2LOCh. 17.5 - Prob. 3LOCh. 17.6 - Prob. 1LOCh. 17.6 - Compare and contrast FISH and gene chip...Ch. 17.6 - Describe how immunoassays can be used to diagnose...Ch. 17.7 - Describe the benefits of creating transgenic...Ch. 17.7 - Prob. 2LOCh. 17.7 - Evaluate issues on each side of the transgenic...Ch. 17 - Prob. 1DACh. 17 - Prob. 2DACh. 17 - Prob. 1IQCh. 17 - Prob. 2IQCh. 17 - You study a gene known to be important in the...Ch. 17 - What is the basis of separation of different DNA...Ch. 17 - Prob. 3UCh. 17 - FISH analysis of a breast tumor biopsy for HER2...Ch. 17 - In terms of studying gene function, what is the...Ch. 17 - The Ti plasmid of Agrobacterium usually induces...Ch. 17 - Prob. 1ACh. 17 - Which of the following statements is accurate for...Ch. 17 - Prob. 3ACh. 17 - Many human proteins, such as hemoglobin, are only...Ch. 17 - Amyloid beta is a proteolytic product of a protein...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A strain of Arabidopsis thaliana possesses a mutation in the APETALA2 gene. As a result of this mutation, much of the 3′ UTR of the mRNA transcribed from the gene is deleted. What is the most likely effect of this mutation on the expression of the APETALA2 gene?arrow_forwardWhen an injury occurs to the skin, the epithelial cells near the wound are signaled to react (by proliferating, migrating, and/or differentiating) to restore the skin in the wound. To investigate the healing process, researchers removed a small area of epithelial cells from the skin of mice, causing a wound. The researchers monitored the acetylation status of histone H4 at lysines K5, K8, and K16 on days 1, 4 and 9 after the wound was made. Cells in three regions were studied (see Figure A below): Normal epithelial cells not directly near the wound Epithelial cells adjacent to the wound The cells repopulating/repairing the wound (referred to as an “epithelial tongue” early in the process and “closed wound” later in the process) The percent of cells that were positive for H4 acetylation was recorded. The bar graph in Figure B below shows data for Days 4 and 9 for cells examined in the wound. While this experiment focused on mice, we may be able to apply the results to…arrow_forwardAccording to the scenario shown, how many segments of DNA (one, two, or three) are removed during site-specific recombination within the gene that encodes the κ (kappa) light chain for IgG proteins? How many segments are spliced out of the pre-mRNA?arrow_forward
- ATM is a kinase that phosphorylates histone H2AX in response to double-stranded DNA breaks. Which of the following scenarios would most quickly regulate ATM activity in the cell? a) Adding silencing methyl groups to cytosines in the Atm gene b) Modifying the histone code for the Atm gene c) Increasing expression of a miRNA specific for the Atm mRNA d) Activating an E3 ubiquitin ligase specific for the ATM proteinarrow_forwardExamination of the histone modifications of a gene reveals an abundance of histone H3 with lysine 27 modified with a single methyl group. Does this suggest that this gene is activated or repressed? How would your answer change if many lysine 27 residues were modified with three methyl groups each?arrow_forwardOften geneticists look for suppressors to find interactive proteins. Which of the type(s) of suppressors you put for part a will help to identify interacting proteins, and which type(s) will not? What are two (or one, if we don’t get a chance to talk about two of them in class) other techniques (not necessarily “genetic” techniques, but at least, lab techniques) that help to identify identifying proteins?arrow_forward
- Huntington disease (HD) is an inherited neurodegenerative disorder characterized by gradual, irreversible impairment of psychological, motor, and cognitive functions. Symptoms typically appear in middle age, but onset can occur at almost any age, and the course of the disease can range from 15 to 20 years. The molecular basis of HD is becoming better understood, and the genetic mutation has been traced to a gene that encodes a large protein of unknown function. In individuals who will not develop HD, a region of the gene that encodes the N-terminus of this protein has a sequence of CAG codons (for glutamine) repeated 6 to 39 times in succession. In individuals with adult-onset HD, this codon (3 nucleotides) is typically repeated 40 to 55 times In those with childhood-onset HD, it is repeated more than 70 times. *codon: refers to the 3 nucleotides that code for amino acid. A small portion of the coding sequence of the HD gene is given below. The nucleotide sequence of the DNA is…arrow_forwardIf the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individualarrow_forwardYou are studying a mutation in mice, which acts dominantly. Mice that have only one copy of the allele carrying this mutation have a kinky tail phenotype. You identify the gene that the mutation affects and find that the codon that encodes the second amino acid in the predicted protein has been mutated to a stop codon. Would you characterize this mutation as a loss-of-function or a gain-of-function and what specific subtype (hypermorphic, antimorphic, etc. ) within these categories? Explain your reasoning.”arrow_forward
- If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?arrow_forwardConsider the expression “central dogma,” which refers to the flow of genetic information from DNA to RNA to protein. is the word “dogma” appropriate in this context?arrow_forwardWhat are the functions of transcriptional activator proteins and repressor proteins? Explain how they work at the molecular level.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Information Storage and the Brain: Learning and Memory; Author: Professor Dave Explains;https://www.youtube.com/watch?v=PQDiUKwXLVI;License: Standard youtube license