Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 19, Problem 1RQ
Summary Introduction
To review:
Definition of the following terminologies:
Codon
Anticodon
Genetic Code
Open Reading Frame
Codon Usage Bias
Introduction:
The terminologies codon, anticodon, genetic code, open reading frame (ORF), and codon usage bias are associated with the translation of a messenger ribonucleic acid (mRNA) strand into a polypeptide. All of the above, except codon usage bias, are
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Question 2:
Part a: Complete the table describing different components of intron removal from mRNA. Nu:, X and Y refer to B-type chemistry shown on the previous page. (YELLOW table shown)
Part b: Complete the table describing different components of group I self-splicing intron removal from 26S rRNA in Tetrahymena. (BLUE table shown)
Part c: Draw the intron with an all atom structure for Branchpoint A after intron removal from mRNA
Part d: Draw the Group I self-splicing intron with an all atom structure for the Guanosine cofactor after intron removal from 26S rRNA in Tetrahymena.
What is unusual about the answers for Questions 13k, 13l, 13m, and 13n? Because the multiple codons exist for most amino acids, the genetic code is said to be _____________.
As we focused on the genetic code and the transcription of genetic information stored in DNA into complementary RNA molecules. Along the way, we found many opportunities to consider the methods and reasoning by which much of this information was acquired. From the explanations given in the chapter, what answers would you propose to the following fundamental questions:
Question: How were the experimentally derived triplet codon assignments verified in studies using bacteriophage MS2?
Chapter 19 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 19 - Prob. 1QCh. 19 - Prob. 2QCh. 19 - Prob. 3QCh. 19 - Prob. 4QCh. 19 - Prob. 5QCh. 19 - Prob. 1RQCh. 19 - Prob. 2RQCh. 19 - Prob. 3RQCh. 19 - Prob. 4RQCh. 19 - Prob. 5RQ
Ch. 19 - Prob. 6RQCh. 19 - Prob. 7RQCh. 19 - Prob. 8RQCh. 19 - Prob. 9RQCh. 19 - Prob. 10RQCh. 19 - Prob. 11RQCh. 19 - Prob. 12RQCh. 19 - Prob. 13RQCh. 19 - Prob. 14RQCh. 19 - Prob. 15RQCh. 19 - Prob. 16RQCh. 19 - Prob. 17RQCh. 19 - Prob. 18RQCh. 19 - Prob. 19RQCh. 19 - Prob. 20RQCh. 19 - Prob. 21RQCh. 19 - Prob. 22RQCh. 19 - Prob. 23RQCh. 19 - Prob. 24RQCh. 19 - Prob. 25RQCh. 19 - Prob. 26RQCh. 19 - Prob. 27RQCh. 19 - Prob. 28RQCh. 19 - Prob. 29RQCh. 19 - Prob. 30RQCh. 19 - Prob. 31RQCh. 19 - Prob. 32RQCh. 19 - Prob. 33RQCh. 19 - Prob. 34RQCh. 19 - Prob. 35RQCh. 19 - Prob. 36RQCh. 19 - Prob. 37RQCh. 19 - Prob. 38RQCh. 19 - Prob. 39RQCh. 19 - Prob. 40RQCh. 19 - Prob. 41RQCh. 19 - Prob. 42RQCh. 19 - Prob. 43RQCh. 19 - Prob. 44RQCh. 19 - Prob. 45FBCh. 19 - Prob. 46FBCh. 19 - Prob. 47FBCh. 19 - Prob. 48FBCh. 19 - Prob. 49FBCh. 19 - Prob. 50FBCh. 19 - Prob. 51FBCh. 19 - Prob. 52FBCh. 19 - Prob. 53FBCh. 19 - Prob. 54FBCh. 19 - Prob. 55SACh. 19 - Prob. 56SACh. 19 - Prob. 57SACh. 19 - Prob. 58SACh. 19 - Prob. 59SACh. 19 - Prob. 60TQCh. 19 - Prob. 61TQCh. 19 - Prob. 62TQCh. 19 - Prob. 63TQCh. 19 - Prob. 64TQCh. 19 - Prob. 65TQCh. 19 - Prob. 66TQCh. 19 - Prob. 67TQCh. 19 - Prob. 68TQCh. 19 - Prob. 69TQCh. 19 - Prob. 70TQCh. 19 - Prob. 71TQCh. 19 - Prob. 72TQCh. 19 - Prob. 73TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Hello , please help me with this question. I am struggling with naming the Amino Acid sequence from the RNA sequence . thank you ,arrow_forwardQuestion 14 A large RNA–protein complex responsible for RNA splicing is called: Question 14 options: Spliceosome Splicing complex Exon-intron processor Transcription complex Question 15 Shortly after transcriptional initiation by RNA polymerase II, a methylated nucleoside (7-methylguanosine, m7G) is added and linked by a 5′–5′ phosphodiester bond to the first 5′ nucleotide, What is this process called? Question 15 options: 3' Capping 5' Capping Polyadenylation Splicing Question 16 During polyadenylation, the RNA is cleaved at a specific site. The site is: Question 16 options: 15–30 nucleotides downstream of the AAUAAA sequence 15–30 nucleotides upstream of the AAUAAA sequence at AAUAA sequence At…arrow_forwardTopic is central dogma of molecular biology Question: 4. Assuming the translation product is an enzyme, explain its role in the final expression of a phenotype. Please explain it to me thank youarrow_forward
- As we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion What experimental information verifies that certain codonsin mRNA specify chain termination during translation?arrow_forwardLactose permease, a protein of E. coli, is composed of a single polypeptide that is 417 amino acids in length. By convention, the amino acids within a polypeptide are numbered from the aminoterminus to the carboxyl-terminus. Are the following questions about lactose permease true or false? A. Because the 64th amino acid is glycine and the 68th amino acid is aspartic acid, the codon for glycine, 64, is closer to the 3′ end of the mRNA than the codon for aspartic acid, 68. B. The mRNA that encodes lactose permease must be greater than 1241 nucleotides in length.arrow_forwardWhat specific roles do translation factors play in both prokaryotic and eukaryotic translation processes?arrow_forward
- QUESTION NO. 1 Base excision repair A. is used only for bases that have been deaminated. B. uses enzymes called DNA glycosylases to generate an abasic sugar site. C. removes about 10 to 15 nucleotides. D. does not require an endonuclease. E. recognizes a bulky lesion. QUESTION NO. 2 Termination of a prokaryotic transcriptA. is a random process. B. requires the presence of the rho subunit of the holoenzyme. C. does not require rho factor if the end of the gene contains a G-C rich palindrome. D. is most efficient if there is an A-T-rich segment at the end of the gene. E. requires an ATPase in addition to rho factor. QUESTION NO. 3 Eukaryotic transcription A. is independent of the presence of upstream consensus sequences. B. may involve a promoter located within the region transcribed rather than upstream. C. requires a separate promoter region for each of the three ribosomal RNAs transcribed. D. requires that…arrow_forwardKindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCGarrow_forwardWhat aminos acid would the anticodon GAC be translated into? Please explain how you went about getting to the answer to the question.arrow_forward
- QUESTION NO. 1 A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B. results from the insertion of one or two bases into the DNA chain. C. is most frequently caused by chemicals (like acridine) that intercalate into DNA. D. results from substitution of one purine for another or of one pyrimidine for another. E. always is a missense mutation QUESTION NO. 2 Degeneracy of the generic code denotes the existence of A. multiple codons for a single amino acid. B. codons consisting of only two bases. C. base triplets that do not code for any amino acid. D. different systems in which a given trip let codes for different amino acids. E. codons that include one or more of the unusual bases. QUESTION NO. 3 Replication A. requires that a phosphodiester bond of the incoming dNTP be hydrolyzed in order to be added to the growing chain. B. uses 5' to 3' polymerase activity to synthesize one…arrow_forwardWhat is the difference between eukaryotes and prokaryotes in terms of initiator tRNA?arrow_forwardQUESTION 48 Identify the best match between the mutation description and term. a. Synonymous mutation: has the potential to cause large changes in transcription and subsequence amino acid sequence due to reading frameshifts b. Nonsense mutation: causes a drastic change in phenotype because the change causes a premature stop in the amino acid sequence c. Indel: a change in the DNA that changes the codon code from one amino acid to another amino acid d. Missense mutation: results in a change in single nucleotide from a purine to another purine or a pyrimidine to another pyrimidine but does not change the amino acid sequencearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY