BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 29, Problem 3P
Interpretation Introduction
Interpretation:
The reason as to why DNA synthesis proceeds in a
Concept introduction:
DNA stands for deoxyribonucleic acid, is a biological macromolecule. DNA contains double helical strands along with the complementary base pairs. The four complementary bases of DNA are adenine (A), thymine (T), guanine (G) and cytosine (C). In the formation of recombinant DNA, the restriction enzymes are involved to cut the particular region in the DNA molecule.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
. Explain why DNA is stable in the presence of alkali (0.3 M KOH),
while RNA is quantitatively degraded to 2'- and 3'-nucleoside
monophosphates under these conditions.
. Pancreatic deoxyribonuclease I (DNase I) is a nuclease that makes
single-strand nicks on double-stranded DNA. It has been observed
that treatment of nucleosomal core particles with DNase I yields a
peculiar result. When DNA from such a digestion is electrophoresed
under denaturing conditions, the single-stranded fragments are
observed to occur in a regular periodicity of about 10 bases. Suggest
an explanation of this result in terms of the structure of the nucleo-
some.
Read it carefully.. Draw only correct diagrams..
In the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C).
1. Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction.
2. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.
Chapter 29 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- What molecular biology strategy can best be used to determine Inhibition of DNA synthesis? Explain.arrow_forwardHow many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forwardYes or no? for each gene, transcription is initiated at origin of replication. does pre mrna shorter than mrna? Does one thousand microliters less than a milliliter?arrow_forward
- Original sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward. What is wobble base-pairing? According to Wobble's rule, one tRNA is sufficient to decode the three codons of threonine (ACU, ACC, and ACA). Explain the phenomenon?arrow_forward4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? 4B. If the DNA duplex for the beta chain of haemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forward
- Show all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?arrow_forward. The following synthetic polynucleotide is synthesized and used as a template for peptide synthesis in a cell-free system from E. coli. .AUAUAUAUAUAUAU-. What polypeptide would you expect to be produced? Precisely what information would this give you about the code?arrow_forwardDraw a replication bubble. Be sure to label the directionality of all strands of DNA. For one of the two replication forks, draw and label all of the proteins required the text describes as being important for DNA synthesis, and label the leading and lagging strands.arrow_forward
- 1a. What do DNA polymerases need to be able to synthesize a new strand of DNA? In 1970, Fred Sanger and colleagues published a DNA sequencing procedure based on the principles of DNA replication. This procedure uses in vitro DNA synthesis in the presence of radioactive nucleotides and specific chain-terminators. These specific chain terminators lack a 3' hydroxyl group and are called 2', 3' – dideoxyribonucleoside triphosphates. This means that once a chain terminator is built into the newly synthesized strand, no further synthesis can occur on that particular strand. They are most usually labelled with radioactive 355 (isotope 35 of sulphur). Four reactions are assembled, each containing one each of 2', 3' - dideoxythymidine triphosphate (ddTTP), ddCTP, ddATP or ddGTP. In each reaction tube, all the fragments will end with same base (T, C, A or G). These reactions are each loaded in their own lane and separated by gel electrophoresis, exposed to autoradiograph film (X-ray film) and…arrow_forward4A. In the human gene for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood cells), the first 30 nucleotides in the amino-acid-coding region is represented by the sequence: 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand?arrow_forward. The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution muta- tions (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons. (a) How many total mutations are possible? (b) How many of these mutations are "silent," in the sense that the mutant codon is changed to another Arg codon? (c) How many of these mutations are conservative, in the sense that an Arg codon is changed to a functionally similar Lys codon?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License