Concept explainers
(a)
Interpretation:
The type of the radioactive material needs to be determined that is added to the culture medium considering that DNA is supposed to be radioactively labeled but not RNA, in dividing and growing bacterial cell.
Concept introduction:
Nucleotides are the construction buildings of
(b)
Interpretation:
A product comprising DNA polymerase and primed model DNA must be supplemented with precursors. Also, where core phosphorous atoms are evenly marked with 32P, the location of radioactive atoms in these precursors when the DNA is to be ready should be stated.
Concept introduction:
DNA elongation performs in 5’-3’direction. Chain elongation reaction takes place when 3-hydroxyl group attacks the innermost phosphorus atom of deoxy nucleoside triphosphate. In the
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
Biochemistry
- Number of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “average� human chromosome?arrow_forwardSemiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.arrow_forwardMolecules of DNA Polymerase III per Cell vs. Growth Rate It is estimated that there are 40 molecules of DNA polymerase III per E. coli cell, is it likely that the growth rate of E. coli is limited by DNA polymerase III availability?arrow_forward
- signal transduction- yeast genetics In one sentence, what is the URA3- to URA3+ conversion with plasmid transformation? Why is it necessary to do this first?arrow_forwardQuestion:- Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.arrow_forwardINSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A Carrow_forward
- How would I solve this? primer (5’ TCAAAACG 3’ ) is shown hybridized to its template DNA below. Let’s say this DNA is used in a Sanger Sequencing reaction. How long (in nt) will dev the shortest RED nucleic acid chain be given that the red fluorophore is attached re to the ddCTP?arrow_forward4a in context to taking genomic DNA from eukaryotic cells and randomly shearing it into pieces of a constant size, why do some of the genomic DNA fragments re-nature so much more quickly than other fragmentsarrow_forwardMay you please help me with this? A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An aliquot was removed from the reaction mixture every minute for 5 minutes and the A260 recorded. The following data were obtained. Time (min) A260 0 0.60 1 0.64 2 0.67 3 0.70 4 0.72 5 0.73 Describe the action of deoxyribonuclease on DNA and explain the increase in A260.arrow_forward
- Central Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?arrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forward1d) Whether done manually or automated, DNA sequencing gels are always made of polyacrylamide rather than agarose. Why can't agarose be used for a sequencing gel, as it is for other DNA gel electrophoresis?arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning