Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4, Problem 20P
Interpretation Introduction
Interpretation:
The given solution contains DNA polymerase and
Concept introduction:
DNA carries the genetic code and genetic information of animals, plants, and bacteria. Friedrichfound the DNA for the first time in 1869. Francis Crick and James Watson first recgnized their molecular structure at the Cavendish Laboratory at Cambridge University in 1953. DNA primers with particular sequences in a single-stranded DNA molecule that bind to DNA. DNA strand is composed of Adenine, Guanine, Thymine, and Cytosine.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explain
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except:
a)requires all four ribonucleoside triphosphates and a DNA template.
b)can extend an RNA chain and initiate a new chain.
c)recognizes specific start signals in DNA.
d)produces an RNA polymer that begins with a 5'-triphosphate.
e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
May you please help me with this?
A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An
aliquot was removed from the reaction mixture every minute for 5 minutes and
the A260 recorded. The following data were obtained.
Time (min) A260
0 0.60
1 0.64
2 0.67
3 0.70
4 0.72
5 0.73
Describe the action of deoxyribonuclease on DNA and explain the increase in
A260.
Chapter 4 Solutions
Biochemistry
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Biochemist Erwin Chargaff was the first to note that, in DNA, [A] = [T] and [G]= [C], equalities now called Chargaff’s rule. Using this rule, determine the percentages of all the bases in DNA that is 20% thymine.arrow_forwarda. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG..... TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT complementary strand: b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid. polypeptide sequence: does the sense strand DNA sequence have 5’ and 3’ UTR sequences? 5'UTR = 3'UTR =arrow_forwardPlease help C. Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?arrow_forward
- Quick help Only cell biology Which process is described in the following paragraph? During DNA synthesis, before the enzyme adds the next nucleotide to a growing DNA strand, it checks whether the previously added nucleotide is correctly base-paired to the template strand. If so, the polymerase adds the next nucleotide; if not, the polymerase clips off the mispaired nucleotide and tries again. This is carried out by cleaving the phosphodiester backbone using the enzyme’s 3’-to-5’ exonuclease activity.arrow_forwardQuestion:- Explain why there are very few sequence-specific DNA-binding proteins that bind to the minor groove of double-stranded DNA.arrow_forwardCentral Dogma of Molecular Biology from DNA to RNA to Protein, discussing the principles underlying the transfer of information in a biologic system and its regulation. However, recent research seems to challenge certain aspects of Crick’s Central Dogma. Does the Central Dogma still stand today? If not, can you find an example for a type of information transfer that is not explicitly covered by the Central Dogma (or even violates it)?arrow_forward
- signal transduction- yeast genetics In one sentence, what is the URA3- to URA3+ conversion with plasmid transformation? Why is it necessary to do this first?arrow_forwardNot just generic "degradation" or even shorter DNA fragments, what specific structure change in double-stranded DNA does the hyperchromicity effect show?arrow_forward"Five prime to three prime" description of a DNA strand refers to: A. the phosphodiester backbone of DNA. B. the phosphorylated 5' carbon at one end, the 3' at the other end. C. the phosphorylated 5' carbon on one sugar and the 3' carbon on the next sugar. D. the location of the hydroxyl groups. KM of a Michaelis–Menten is proportional to: A. The concentration of the ES complex B. The concentration of the substrate C. Both A and B D. Neither A nor Barrow_forward
- Can you help with 1a please HELPFUL INFORMATION: When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. 1a. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?arrow_forwardGenetic application problem A couple in which the woman belongs to group 0 Rh- and the man is AB Rh + claim as theirs a baby whose blood is A Rh +. What would you think as a judge about this lawsuit? Explain...arrow_forwardTick the correct statements: Remember: Tautomers are structural isomers that differ from each other based on the position of the proton(s) and their double bonds. ( ) The nitrogenous bases of nucleic acids, which contain heterocyclic and analogous nuclei, can adopt different tautomeric forms involving multiple H+ that are exchangeable depending on the medium. In DNA, spontaneous formation of smaller tautomers appears to contribute to mutagenic errors during DNA replication, while in RNA, they seem to be related to increased structural and functional diversity of enzymes and RNA aptamers (research this and confirm if it is false or real) ( ) in relation to the figure, anomer 1 has beta stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) in relation to the figure, anomer 1 has alpha stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) In general, in naturally occurring nucleosides,…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License