Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 4, Problem 37P
Interpretation Introduction
Interpretation:
The concept of the degeneracy of genetic code needs to be explained.
Concept introduction:
When a four-letter DNA code is interpreted into a 20-letter code of amino acids, the set that is formed is known as a genetic code. These serve as the foundation for the formation of proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.
DNA: Why does histone modifications matter?
Calculating human genome
If 1.5 percent of the human genome consists of protein-coding sequences, and the entire genome has 3.2x10^9, how many codons are there in the human genome? Remember that a codon is three nucleotides in length.
Chapter 4 Solutions
Biochemistry
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- A mutation called base substitution mutation had been altered the sequence in a. eliminated the synthesis of all the polypeptide except one. The altered sequence is 5’ – AUGCAUACCUAUGUGACCCUUGGA – 3’. Use the genetic code table and determine why.arrow_forwardRemember remove the introns! All introns start with GT and end with AG.arrow_forwardDifferent types of mutations and how to use the genetic code table.arrow_forward
- True or False? Eukaryotic genomes are organized into operons; each operon consists of a series of genes which code for enzymes involved in a metabolic pathway, under the transcriptional control of a single promoter sequence .arrow_forwardINSTRUCTION: Given the DNA sequence below, provide the answers to the following items. a. complimentary DNA strand 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C b. mRNA 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A C c. protein synthesized 1.) G A A A T G A C C A G A T T T A T G G C C T G A 2). A T G C G A C C T T A A G T C A A T T G C G A Carrow_forwardbriefly explain the importance of the degeneracy of the genetic code in the translation process. do not simply define the givenarrow_forward
- Need help:. Researchers add poly-(CGU) to an in vitro TL system. What poly-amino acids are produced? How would the researchers determine which codon encoded each of these amino acids? 5’CGUCGUCGUCGUCGUCGUCGUCGU...3’arrow_forwardEvidence that each nucleotide is partof only one codon EXPLAINarrow_forwardHi, Can someone solve this question, what are the steps of translation in order based on when they occur? It would be nice if some solved itarrow_forward
- Only answer please, no need to explain… Thank you for your time. i: Modification of the 5 prime ends of eukaryotic mRNA is called? a) Capping b) Polyadenylation c) Splicing d) Transcription ii: Genetic Code is? a) The sequence of Nitrogenous Bases in mRNA that codes for a protein b) Is a Triplet Code c) is Non-Overlapping d) All of these iii. The process of formation of RNA is known as a) Replication b) DNA repair c) Translation d) Transcription iv. Which of the following statement is NOT true regarding transcription/RNA synthesis? a) RNA synthesis occurs in the nucleus b) Unlike DNA synthesis, the only selective sequence of DNA is transcribed to RNA c) RNA synthesis requires a short stretch of RNA primers d) DNA sequences, specific proteins, and small RNAs regulate RNA synthesisarrow_forward100All tRNA molecules have poly (A) tails at their 3' end. Yesornoarrow_forwardPLEASE ANSWER WHY? Some substitution mutation result in a malfunctioning protein but others do not. Why is this? arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY