Biochemistry
Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
bartleby

Videos

Question
Book Icon
Chapter 4, Problem 50P
Interpretation Introduction

Interpretation:

The reason for the mixture of poly(A), poly(B) and the three DNAs shown in the curve to vary with respect to the C0t value needs to be explained.

Concept introduction:

The C0t value analysis is a technique used to measure the complexity in the size of DNA or gene and this technique is based on DNA renaturation kinetics.

This technique states the following principles:

  • Renaturation rate is directly proportional to the number of times the sequences exist on the DNA Strand.
  • When enough time is given all the denatured DNA are re-associated or reannealed.
  • Renaturation takes the least time when there is more repetition of the sequences.

The renaturation process carried out by heating the DNA and allowing it to cool down to reanneal.

The C0t value depends on − DNA Concentration, reassociation temperature, cation concentration, and viscosity and is given by the equation:

C0t value = DNA Concentration (moles/L)×Renaturation time (Secs)×Buffer Factor

Lower C0t value shows more repetition of sequences while Higher C0t value indicates a greater number of unique sequences.

Blurred answer
Students have asked these similar questions
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.)   5’- TAAGCGTAACACGCTAA   CAGTAATGCAGAACT   GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT    GTCATTACGTCTTGA     CCCAGGATAAAAGCACGCATGTG -5’   Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
MUTATION: Fill in the correct nucleotide base pairing and amino acid sequence of the mutated DNA -Answer/fill the blank circles provided in the image.
Give only typing answer with explanation and conclusion A DNA ligase: None of the listed answers Can join two fragments of DNA binding the phosphodiester backbone with covalent bonds. All of the listed answers -not the correct answer Can recognize specific sequences that allow for the detection of SNPs. Can replicate a complementary DNA strand using a single stranded DNA template.
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY