Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 7P
The following picture shows the ethidium bromide–stained bands revealed by gel electrophoresis of two different DNA samples digested with two different restriction enzymes. One of the DNAs is human genomic DNA, the other is the small genome of a bacteriophage (bacterial virus) that infects E. coli cells. One of the restriction enzymes is EcoRI (5′ G^AATTC 3′); the other is HpaII (5′ C^CGG 3′). For each of the four lanes on the gel (A–D), identify which of the two DNA samples was analyzed and which of the two restriction enzymes was used to digest that DNA. The arrow represents the direction of electrophoresis.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.
The sequences below indicated the 6bp recognition site for the restriction enzyme EcoRI. The lines indicate the sites where the enzyme will cut each strand. 1). write the sequence and structure of the two DNA pieces after the enzyme cuts (hydrogen bonds holding the strands together between the lines are broken after enzyme cuts) 2). indicate whether EcoRI generates blunt or sticky overhangs
5'- G I A A T T C - 3'
3' - C T T A A l G - 5'
After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present.
In the tables below G^AATTC means that the end after cutting with enzyme will be:
-----G 3'
-----CTTAA 5'
GTGCA^C means that the end will be:
-----GTGCA 3'
-----C 5'
Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang?
AccI
GT^CGAC
BamHI
G^GATCC
ClaI
AT^CGAT
NsiI
ATGCA^T
PstI
CTGCA^G
BglII
A^GATCT
TaqI
T^CGA
Chapter 9 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 9 - Match each of the terms in the left column to the...Ch. 9 - For each of the restriction enzymes listed below:...Ch. 9 - The calculations of the average restriction...Ch. 9 - The DNA molecule whose entire sequence follows is...Ch. 9 - Why do longer DNA molecules move more slowly than...Ch. 9 - Agarose gels with different average pore sizes are...Ch. 9 - The following picture shows the ethidium...Ch. 9 - The linear bacteriophage genomic DNA has at each...Ch. 9 - Consider a partial restriction digestion, in which...Ch. 9 - The text stated that molecular biologists have...
Ch. 9 - a. What is the purpose of molecular cloning? b....Ch. 9 - a. DNA polymerase b. RNA polymerase c. A...Ch. 9 - Is it possible that two different restriction...Ch. 9 - A plasmid vector pBS281 is cleaved by the enzyme...Ch. 9 - A recombinant DNA molecule is constructed using a...Ch. 9 - Suppose you are using a plasmid cloning vector...Ch. 9 - Prob. 17PCh. 9 - The lacZ gene from E. coli encodes the enzyme...Ch. 9 - Your undergraduate research advisor has assigned...Ch. 9 - Which of the enzymes from the following list would...Ch. 9 - You use the primer 5 GCCTCGAATCGGGTACC 3 to...Ch. 9 - a. To make a genomic library useful for sequencing...Ch. 9 - Problem 15 showed part of the sequence of the...Ch. 9 - Eukaryotic genomes are replete with repetitive...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the following image of a stained agarose gel representing the separation of a plece of DNA that has been digested by a series of restriction enzymes. Assume no digest fragment is of identical size to another digest fragment. nucleotide pairs (kb) 8 S 45 3.5 AA size Hindill + markers EcoRI Hindill EcoRI - 1st attempt Based on all data presented in the stained agarose gel, which of the following statements is correct? Choose one: OA. The original piece of DNA was circular and was cut by EcoRI twice and Hindill only once. OB. The original piece of DNA was linear and was cut by EcoRI twice and Hindill only once. OC. The original piece of DNA was circular and was cut by EcoRI once and not at all by Hind!!!.arrow_forwardYou are studying a new plasmid, and you digest the plasmid with three restriction enzymes: Eco RI (E), HindlII (H), and Xbal (X). You digest the plasmid DNA with each of the following combinations of enzymes and observe the results on an agarose gel. You are provided a partial plasmid map as shown below to the right. E+H E+X H+x Kb +4.3 +2.8 -+2.5 -2.0 - -1.8 +1.5 -1.0 12 F0.8 +0.5 a. What is the size of this plasmid in base pairs? b. What is the distance in base pairs between E1 and H? c. What is the distance in base pairs between E1 and X? d. What is the distance in base pairs between E2 and H? e. What is the distance in base pairs between E2 and X?arrow_forwardA 2.0kb bacterial plasmid ‘BS1030’ is digested with the restriction endonuclease Sau3A; the plasmid map is depicted in the diagram below and the Sau3A (S) restriction sites are indicated. Which of the following DNA fragments do you expect to see on an agarose gel when you run Sau3A-digested plasmid ‘BS1030’ DNA? a. 250 bp, 450 bp, 550 bp, 1.1 kb, 1.5 kb and 2.0 kb b. 2.0kb c. 250 bp, 400 bp, 450 bp, 500 bp and 550 bp d. 100 bp, 200 bp, 250 bp, 400 bp, 500 bp and 550 bparrow_forward
- A plasmid DNA and a linear DNA (both of the same size) have one site for a restriction endonuclease. When cut and separated on agarose gel electrophoresis, plasmid shows one DNA band while linear DNA shows two fragments. Explain.arrow_forwardA molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G + C. How many times, on average, are restriction sites for the following restriction enzymes likely to be present in this DNA molecule? a. HindIII (recognition sequence is AAGCTT)arrow_forwardThe partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given abovearrow_forward
- The short DNA shown below is to be sequenced. Using your knowledge of how the Sanger method works, in the gel diagram, draw in the bands that will appear when DNA polymerase is added to the reaction along with the four different nucleotide mixtures indicated. Note that some of these mixtures are not what would normally be used in a sequencing reaction. Dideoxynucleatides (ddNTPs) are added in relatively small amounts. The asterisk represents a radioactive label. *5' - 3'-ОН 3' – -- ACGACGCAGGACATTAGAC-5' Nucleotide mixtures: A. DATP, DTTP, dCTP, DGTP, ddTTP (given) B. DATP, ATTP, dCTP, AGTP, ddATE C. dTTP, dGTP. ACTP, ddCTP, ddATP D. DATP, dCTP, dTTP, ddGTP A в с D | || ||arrow_forwarda)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer presentarrow_forwardA piece of DNA 5.0 kb long is cloned and then cut out of the vector for analysis. This linear piece of DNA is digested with two restriction enzymes, EcoRI and BamHI, individually and in combination, and the resulting fragment sizes are determined by electrophoresis. The results are as follows: Restriction fragment size 4.5 kb; 0.5 kb 3.0 kb; 2.0 kb 2.5 kb; 2.0 kb; 0.5 kb Enzyme name EcoRI ВатHI EcoRI + BamHI Construct a potential restriction map based on these results.arrow_forward
- A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis.The following data were obtained. (a) Is the original molecule linear or circular?(b) Draw a map of restriction sites (showing distances between sites) that isconsistent with the data given.(c) How many additional maps are compatible with the data?(d) What would have to be done to locate the cleavage sites unambiguouslywith respect to each other?arrow_forwardThere are three classes of restriction enzymes; Class I, Class II and Class II. Nevertheless, Class II is most popular in recombinant technology. Explain the reason behind this.arrow_forwardGiven the DNA sequence of the restriction enzyme: gi|6329444|dbj|AB034757.1| Hynobius retardatus mRNA for larval beta-globin, complete cds GCAGAATCTGACTCAAGAAATCCCTCCTCACCCAACACCACCAGCAGCCATGGTTCACTGGACAGCAGAGGAGAAGGCAGCCATCAGCTCTGTGTGGAAGCAGGTGAACGTGGAGAGCGATGGACAGGAGGCCCTGGCCAGGTTGCTGATCGTCTACCCCTGGACCCAGAGATACTTCAGCTCTTTTGGGGACCTGTCGAGCCCAGCTGCCATTTGTGCCAACGCCAAGGTCCGTGCCCATGGCAAGAAGGTCCTGTCCGCCCTGGGAGCCGGCGCCAACCACCTGGATGACATCAAAGGCAACTTTGCTGATCTGAGCAAGCTTCACGCAGACACACTCCATGTGGACCCCAATAACTTCCTGCTCCTGGCAAACTGCCTGGTGATCGTCTTGGCCCGCAAGCTGGGAGCCGCCTTCAACCCTCAAGTCCATGCGGCCTGGGAGAAGTTCCTGGCCGTCTCCACCGCGGCTCTGTCCAGAAACTACCACTAGAGACTGGTCTTTGGGTTTAATTCTGTGAACGTCCCTGAGACAAATGATCTTTCAATGTGTAAACCTGTCATTACATCAATAAAGAGACATCTAACAAAAAAAAAAAAAAAAAAAAAAAAAA Identify two blunt-end cutters Identify two sticky-end cutters. For each, Provide the sequence of the Restriction enzyme, Highlight using a specific color where the DNA sequence where the restriction enzyme will cut the DNA Indicate the…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License