Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 4P
The DNA molecule whose entire sequence follows is digested to completion with the enzyme EcoRI (5′ G^AATTC 3′). How many molecules of DNA would result from this reaction? Write out the entire sequence(s) of the resultant DNA molecule(s), indicating all relevant 5′-to-3′ polarities. What about this problem appears unusual (though by no means impossible) in relationship to DNA made of random
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?
A circular, double-stranded DNA contains 2100 base pairs. The
solution conditions are such that DNA has 10.5 bp/turn.
(a) What is Lo for this DNA?
(b) The DNA is found to have 12 left-handed superhelical turns.
What is the superhelix density o?
What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5)
If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5)
If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5)
What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)
Chapter 9 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 9 - Match each of the terms in the left column to the...Ch. 9 - For each of the restriction enzymes listed below:...Ch. 9 - The calculations of the average restriction...Ch. 9 - The DNA molecule whose entire sequence follows is...Ch. 9 - Why do longer DNA molecules move more slowly than...Ch. 9 - Agarose gels with different average pore sizes are...Ch. 9 - The following picture shows the ethidium...Ch. 9 - The linear bacteriophage genomic DNA has at each...Ch. 9 - Consider a partial restriction digestion, in which...Ch. 9 - The text stated that molecular biologists have...
Ch. 9 - a. What is the purpose of molecular cloning? b....Ch. 9 - a. DNA polymerase b. RNA polymerase c. A...Ch. 9 - Is it possible that two different restriction...Ch. 9 - A plasmid vector pBS281 is cleaved by the enzyme...Ch. 9 - A recombinant DNA molecule is constructed using a...Ch. 9 - Suppose you are using a plasmid cloning vector...Ch. 9 - Prob. 17PCh. 9 - The lacZ gene from E. coli encodes the enzyme...Ch. 9 - Your undergraduate research advisor has assigned...Ch. 9 - Which of the enzymes from the following list would...Ch. 9 - You use the primer 5 GCCTCGAATCGGGTACC 3 to...Ch. 9 - a. To make a genomic library useful for sequencing...Ch. 9 - Problem 15 showed part of the sequence of the...Ch. 9 - Eukaryotic genomes are replete with repetitive...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- State the properties of the WatsonCrick model of DNA in the following categories: a. number of polynucleotide chains b. polarity (running in same direction or opposite directions) c. bases on interior or exterior of molecule d. sugar/phosphate on interior or exterior of molecule e. which bases pair with which f. right- or left-handed helixarrow_forwardDNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?arrow_forwardHow many possible nucleotide sequences are there for a stretch of DNA that is N nucleotides long, if it is (a) single- stranded or (b) double-stranded?arrow_forward
- The base analog 5-bromouracil (5BU), which sterically resembles thymine, more readily undergoes tautomerization from its keto form to its enol form than does thymine. 5BU can be incorporated into newly synthesized DNA when it pairs with adenine on the template strand. However, the enol form of 5BU pairs with guanine rather than adenine. (a) Draw the 5BU · G base pair. (b) What type of mutation results?arrow_forwardThe Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardBased on Chargaff’s rules, if a segment of DNA is composed of 20% adenine (A) bases, what is the percentage of guanine (G)?arrow_forward
- When DNA is heated, it denatures; that is, the strands separate because hydrogen bonds are broken and some base-stacking and hydrophobic interactions are disrupted. The higher the temperature, the larger the number of hydrogen bonds that are broken. After reviewing DNA base pair structure, determine which of the following molecules will denature first as the temperature is raised. Explain your reasoning. a. 5′-GCATTTCGGCGCGTTA-3′ 3′-CGTAAAGCCGCGCAAT-5′ b. 5′-ATTGCGCTTATATGCT-3′ 3′-TAACGCGAATATACGA-5′arrow_forwardThe two sides of the DNA double helix are connected by pairs of bases (adenine, thymine, cytosine, and guanine). Because of the geometric shape of these molecules, adenine bonds with thymine and cytosine bonds with guanine. The figure below shows the bonding of thymine and adenine. Each charge shown is +e or - e, and the H-N distance is 0.110 nm. (a) Calculate the net force that thymine exerts on adenine. Is it attractive or repulsive? To keep the calculations fairly simple, yet reasonable, consider only the forces due to the O- H-N and the N-H-N combinations, assuming that these two combinations are parallel to each other. Remember, however, that in the O-H-N set, the O- exerts a force on both the H+ and the N-, and likewise along the N–H-N set. (b) Calculate the force on the electron in the hydrogen atom, which is 0.0529 nm from the proton. Then compare the strength of the bonding force of the electron in hydrogen with the bonding force of the adenine-thymine molecules (H (H (H)…arrow_forwardThe DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ): a) The length in meters of this chromosome. b) The approximate number of genes in the chromosome (assuming no wasted DNA).arrow_forward
- In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share all but one of the following properties. Which is the exception? None of the proton-binding groups in the purine and pyrimidine bases is in its charged or ionized form. The plane of the base pair is roughly perpendicular to the axis of the helix in each case. The number of hydrogen bonds formed between the two bases of the base pair is the same. O The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom.arrow_forwardBearing in mind the different number of hydrogen bonds that form between the two different purine- pyrimidine pairs in DNA, how would you explain the fact that DNA that is rich in cytosine-guanine pairs requires heating to a slightly higher temperature in order to separate the strands than DNA that is rich in adenine-thymine pairs?arrow_forwardIf you analyze a double-stranded DNA molecule and find that 15% of all the nucleotide bases are Adenines, you know that there must also be [ Select ] Thymines, [ Select ] Guanines, [ Select ] v Cytosines and [ Select ] Uracils. (Count each of the bases in any double stranded DNA molecule and calculate their percentages to find the simple key for this if you haven't seen it yet.)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license