Genetics: From Genes To Genomes (6th International Edition)
Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 9, Problem 8P

The linear bacteriophage λ genomic DNA has at each end a single-strand extension of 20 bases. (These are sticky ends but are not, in this case, produced by restriction enzyme digestion.) These sticky ends can be ligated to form a circular piece of λ DNA. In a series of separate tubes, either the linear or circular forms of the DNA are digested to completion with EcoRI, BamHI, or a mixture of the two enzymes. The results are shown here.

Chapter 9, Problem 8P, The linear bacteriophage  genomic DNA has at each end a single-strand extension of 20 bases. These

a. Which of a. the samples (A or B) represents the circular form of the DNA molecule? How do you know?
b. What is the total length of the linear form of the λ DNA molecule?
c. What is the total length of the circular form of the λ DNA molecule?
d. Draw diagrams of the circular and linear λ DNA molecules, showing the locations of the EcoRI and BamHI sites.
Blurred answer
Students have asked these similar questions
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the expected number of NotI cleavage sites in the bacteriophage l genome, a linear DNA duplex 48.5 kbp in length with a (G + C) content of 50%.
The restriction endonuclease NciI recognizes and cuts the five-base-pair sequence 5’- CC(G/C)GG-3’ [where (G/C) means either G or C will work at that position]. (1) How often, on average, would this sequence occur in random DNA? Assume the DNA contains 25% each of A, G, T & C. (2) After digestion, Nci1 leaves a one-base 5’ overhang. Write/draw the cut site/digested products.
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license