Concept explainers
Your undergraduate research advisor has assigned you a task: Insert an EcoRI-digested fragment of frog DNA into the vector shown in Problem 19. Your advisor suggests that after you digest your plasmid with EcoRI, you should treat the plasmid with the enzyme alkaline phosphatase. This enzyme removes phosphate groups that may be located at the 5′ ends of DNA strands. You will then add the fragment of frog DNA to the vector and join the two together with the enzyme DNA ligase.
You don’t quite follow your advisor’s reasoning, so you set up two ligations, one with plasmid that was treated with alkaline phosphatase and the other without such treatment. Otherwise, the ligation mixtures are identical. After the ligation reactions are completed, you transform E. coli with a small aliquot (portion) of each ligation and spread the cells on petri plates containing both ampicillin and X-gal. The next day, you observe 100 white colonies and one blue colony on the plate transformed with alkaline-phosphatase-treated plasmids, and 100 blue colonies and one white colony on the plate transformed with plasmids that had not been treated with alkaline phosphatase.
a. | Explain the results seen on the two plates. |
b. | Why was your research advisor’s suggestion a good one? |
c. | Why would you normally treat plasmid vectors with alkaline phosphatase, but not the DNA fragments you want to add to the vector |
Want to see the full answer?
Check out a sample textbook solutionChapter 9 Solutions
Genetics: From Genes To Genomes (6th International Edition)
- please help me with this problemarrow_forwarda)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x 10-14g of a 10 kb template in a 100 µl reaction. Assuming that the molecular weight of the average base pair is 660 Daltons calculate the number of molecules of the template. b)Given that the concentration of each primer (20 base pairs each) is 0.1µM in this same reaction volume (100 µl) calculate the number of molecules of the primer presentarrow_forwardThe chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC. 2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?arrow_forward
- A 12 kb linear DNA fragment is subject to single or double RE digest and agarose gelelectrophoresis, to yield the gel profile shown below. The first lane contains the size marker(M).a) Explain how the name of the enzyme EcoRI is derived.b) How many sites are there for EcoRI and PvuII respectively on this DNA fragment?c) Use the sizes of the DNA bands on the gel to compile a restriction enzyme map of the DNAfragment. Indicate the positions of the restriction enzymes sites for EcoRI and PvuII on themap.arrow_forwardSupercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?arrow_forwardFor the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’arrow_forward
- After restriction enzymes cut, they contain unpaired bases. Type II restriction enzymes leave ends that may be 5' overhanging, 3' overhanging, or blunt. In all cases each end is left with a 3' OH and a 5' phosphate. All blunt ends, and any complementary overhanging ends may be re-ligated with T4 DNA ligase, as long as at least one 5'- phosphate is present. In the tables below G^AATTC means that the end after cutting with enzyme will be: -----G 3' -----CTTAA 5' GTGCA^C means that the end will be: -----GTGCA 3' -----C 5' Which RE’s from table below have a 5’ overhang? Which ones have a 3’ Overhang? AccI GT^CGAC BamHI G^GATCC ClaI AT^CGAT NsiI ATGCA^T PstI CTGCA^G BglII A^GATCT TaqI T^CGAarrow_forwardI’m having trouble finding which answer would be acceptable can you please help?arrow_forwardBased on the electrophoresis experiment, 0.7% agarose gel concentration was used. If the gel concentration increased to 1%, what would happen to the DNA migration? Explain briefly.arrow_forward
- Following base removal, DNA polymerase can add nucleotides in the 5'-to-3' direction. Is that true or False? Why? please help me explain thatarrow_forwardthis is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.arrow_forwardNote that the table provided shows a ligation using a molar ratio of 1:3 vector to insert. Write out the complete recipe for a 5:1 insert: vector ligation reaction, including the volumes of insert and vector you calculated above, and the volumes required for a 20 uL reaction: Ligase buffer Nuclease-free water T4 DNA ligasearrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education