Genetics: From Genes To Genomes (6th International Edition)
Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 9, Problem 25P

Eukaryotic genomes are replete with repetitive sequences that make genome assembly from sequence reads difficult. For example, sequences such as CTCTCTCTCT .(tandem repeats of the dinucleotide sequence CT) are found at many chromosomal locations, with variable numbers (n) of the CT repeating unit at each location. Scientists can assemble genomes despite these difficulties by using the paired-end sequencing strategy diagrammed in Fig. 9.9. In other words, they can make libraries with genomic inserts of defined size, and then sequence both ends of individual clones.

Following are 12 DNA sequence reads from six cloned fragments analyzed in a genome project. 1A and 1B represent the two end reads from clone 1, 2A and 2B the two end reads from clone 2, etc. Clones 1–4 were obtained from a library in which the genomic inserts are about 2 kb long, while the inserts in clones 5 and 6 are about 4 kb long. All of these sequences have their 5′ ends at the left and their 3′ ends at the right. To simplify your analysis, assume that these sequences together represent two genomic locations (loci; singular locus), each of which contains a (CT)n repeat, and that each of the 12 sequences overlaps with one and only one other sequence.

1A: CCGGGAACTCCTAGTGCCTGTGGCACGATCCTATCAAC

1B: AGGACTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT

2A: GTTTTTGAGAGAGAGAGAGAGAGAGAGAGACCTGGGGG

2B: ACGTAGCTAGCTAACCGGTTAAGCGCGCATTACTTCAA

3A: CTCTCTCTCTCTCTCTCTCTCAAAAACTATGGAAATTT

3B: TAGTGATAGGTAACCCAGGTACTGCACCACCAGAAGTC

4A: GGCCGGCCGTTGTTGACGCAATCATGAATTTAATGCCG

4B: TCATGGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA

5A: TAGTGCCTGTGGCACGATCCTATCAACTAACGACTGCT

5B: AAGGAAAGGCCGGCCGTTGTTGACGCAATCATGAATTT

6A: CAGCAGCTAGTGATAGGTAACCCAGGTACTGCACCACC

6B: GGACTATACGTAGCTAGCTAACCGGTTAAGCGCGCATT

a. Diagram the two loci, showing the locations of the repetitive DNA and the relative positions and orientations of the 12 DNA sequence reads.
b. If possible, indicate how many copies of the CT repeating unit reside at either locus.
c. Are the data compatible with the alternative hypothesis that these clones actually represent two alleles of a single locus that differ in the number of CT repeating units?
Blurred answer
Students have asked these similar questions
Eukaryotic genomes are replete with repetitive sequences that make genome assembly from sequencereads difficult. For example, sequences such asCTCTCTCTCT . . . (tandem repeats of the dinucleotide sequence CT) are found at many chromosomallocations, with variable numbers (n) of the CT repeating unit at each location. Scientists can assemblegenomes despite these difficulties by using the pairedend sequencing strategy diagrammed in Fig. 9.9. Inother words, they can make libraries with genomicinserts of defined size, and then sequence both endsof individual clones. Following are 12 DNA sequence reads from sixcloned fragments analyzed in a genome project. 1Aand 1B represent the two end reads from clone 1, 2Aand 2B the two end reads from clone 2, etc. Clones1–4 were obtained from a library in which the genomic inserts are about 2 kb long, while the inserts inclones 5 and 6 are about 4 kb long. All of these sequences have their 5′ ends at the left and their 3′ endsat the right. To simplify…
Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?
The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License