Genetics: From Genes To Genomes (6th International Edition)
Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 9, Problem 24P

Problem 15 showed part of the sequence of the plasmid vector pMBG36. Suppose you make a genomic library by inserting EcoRI-digested fragments of a genome into EcoRI-digested pMBG36. Write out the sequences of two different primers you could use to sequence (in separate reactions) the two ends of all the clones in the library. These primers should be as long as possible based on the information given.

Chapter 9, Problem 24P, Problem 15 showed part of the sequence of the plasmid vector pMBG36. Suppose you make a genomic

Blurred answer
Students have asked these similar questions
In Polymerase Chain Reaction (PCR), the temperature is one of the most important parameters that could influence the efficiency of this technique. Each cycle of this reaction has its own specific temperature. For instance, the denaturation step possesses a temperature of 94 - 98 ℃ to ensure that the double stranded DNA is fully separated. (i) (ii) (iii) Why is the annealing temperature vital in this technique? Explain how will this temperature affects the efficiency of this reaction. Why is Hot Start PCR technique preferred by some researchers? If the primers you purchased possessed the following information. 5'-GGA AAC AGC TAT GAC CAT G-3' Calculate the melting temperature of this primer and estimate the annealing temperature of this primer.
The chain terminator method was used to sequence the following DNA fragment: ACTGGGCATAAGCGGGAACTTTGCAGAACTGGCTGGCCTCAGAGCAGGGA. 1. Predict a band pattern in a gel after sequencing this DNA fragment using a radioactively labeled primer [32P]-5’- TCTGAGGCCAGCCAGTTCTGCAAAGTTC.  2. Due to an experimental mistake, dATP was not added in all four reaction mixtures. How does the band pattern change?
Clone number in this case is number 196 which is shown in the images.  State whether a BamHI site has been re-created at the forward- and the reverse-end junctions of the human DNA with the plasmid vector  band sizes are shown in one of the images. (0.5, 1, 2, 3, 4, 5, 6, 8, 10kb)
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license