+Protein Mr pI 12,000 28,000 42,000 66,000 (a;) 103,000 (a2) 111,000 А В 8.4 C 7.2 9. E 5 F 4.2 Predict how the proteins listed above will behave in a variety of separation and characterization procedures. For each chromatographic technique (you may assume that the protein remains “native," or non-denatured), list the order in which the proteins will elute (come of the end of the column): Size Exclusion Chromatography, pH 6.8 First Last Anion Exchange Chromatography, pH 9, using a salt gradient to elute

+Protein Mr pI 12,000 28,000 42,000 66,000 (a;) 103,000 (a2) 111,000 А В 8.4 C 7.2 9. E 5 F 4.2 Predict how the proteins listed above will behave in a variety of separation and characterization procedures. For each chromatographic technique (you may assume that the protein remains “native," or non-denatured), list the order in which the proteins will elute (come of the end of the column): Size Exclusion Chromatography, pH 6.8 First Last Anion Exchange Chromatography, pH 9, using a salt gradient to elute

Chemistry

10th Edition

ISBN:9781305957404

Author:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Publisher:Steven S. Zumdahl, Susan A. Zumdahl, Donald J. DeCoste

Chapter1: Chemical Foundations

Section: Chapter Questions

Problem 1RQ: Define and explain the differences between the following terms. a. law and theory b. theory and...

See similar textbooks

Similar questions

Principles of separation by capillary Isolachophoresis
Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clear handwritten answer in 2 figures)
Biuret Assay accurately quantify protein concentration within the range of 5-150 mg/mL. JUSTIFY THE STATEMENT.
Silica gel is very polar stationary phase. Therefore, more polar molecule sticks to silica gel on the TLC plate and has higherRfvalue. True False
Briefly explain how cation exchange chromatography can used in protein separation?
In reversed phase partition chromatography Select one: a. the least polar compound elutes first b. the smallest molecular weight compound elutes first c. the most polar compound elutes first d. the largest molecular weight compound elutes first e. the lowest boiling compound elutes first f. the highest boiling compound elutes first
Seperation of Amino Acids by thin layer chromotography Lab. Please answer #12 and #13 as I am very confused. Thank you for your help!
One of the most advanced methods for determining a protein sequence is tandem mass spectrometry (MS/MS). Select from the list of statements below all that applies to MS/MS. Group of answer choices CID is one way of performing tandem MS experiments The experiment start by chopping the protein into smaller peptide fragments using an enzyme These peptide fragments are later introduced into the mass spectrometer to determine their molecular weight Peptide fragments are selected for further fragmentation by collision with an inert gas There are only 4 types of ions which can result from MS/MS fragmentation: a, b, x, and y ions The a and b ions are the ones with the original C terminus, whereas the x and y ions are the ones with the original N-terminus All of the above
Chemistry how would you isolate the glycosylated insulin from the unglhcosylated forms? can you come up with a method to purify the protein (insulin with sugar group)? It can be a column or a combination of columns. (hint: use size exclusion chromatography or other method and affinity concept.)
During TLC, what is the stationary phase and what is the mobile phase?
Please enumerate and explain 1. WHAT ARE THE GENERAL RULES IN GRAMS STAINING CLASSIFICATION OF BACTERIA?
Pick all that are TRUE regarding analysis of quaternary structures of proteins using polyacrylamide electrophoresis:I. The added β-mercaptoethanol disrupts S--S bonds bridging the polypeptide chains causing the appearance of higher Rf bands compared to the native protein run. II. Heating up any protein before subjecting to SDS-PAGE will always result in the formation of more than one band.III. A good asymmetrical gel layout would be : (Lane 1) MW ladder, (2) native protein, (3) protein + β-ME, (4) protein + HCL, (5) protein + β-ME + HCl.IV. Formation of a single band in the protein + β-ME + HCl run, whose Rf is lower than the native run, could be indicative that the protein is a homodimer.A. I onlyB. I and IIC. II and IIVD. None is true.pls explain