GENETIC ANALYSIS: AN INTEG. APP. W/MAS
2nd Edition
ISBN: 9781323142790
Author: Sanders
Publisher: Pearson Custom Publishing
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 5P
Thymine is usually in its normal, common form. Diagram the base pair that would result if a tautomeric shift occurs just before
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Insulin is synthesized as preproinsulin, which has 81 amino acids. How many heterocyclic bases must be present in the informational DNA strand to code for preproinsulin (assuming no introns are present)?
List the four types of noncoding DNA (see Section 27.2). Give the function of each, if it is known.
In chromosomes, doubly-stranded DNA wraps tightly around histone proteins. Think about the structure of DNA, especially the "backbone," and determine what category of
amino acids make up the majority of histones:
Histone Octamer
tetramer
dimer HZA
dimer
dimer
dimer
Histone "fastener"
Here the blue represents histones, and the red is the DNA strand.
To help the DNA fold up in an aqueous environment, the histones are nonpolar to exclude water, so many of the amino acid side chains are nonpolar.
The backbone of DNA is the alternating phosphate-sugar part, and the phosphate is negatively charged. Positive charges on the histone residues will bind tightly here, so
the acidic amino acids are used here.
The backbone of DNA is the alternating phosphate-deoxyribose part, and the phosphate is negatively charged. Positive charges on the histone residues will bind tightly
here, so the basic amino acids are used here.
The histones are strongly attracted to the hydrogen-bonding of the base pairs, so…
Chapter 12 Solutions
GENETIC ANALYSIS: AN INTEG. APP. W/MAS
Ch. 12 - 11.1 Identify two general ways chemical mutagens...Ch. 12 - 11.2 Nitrous acid and (BU) alter DNA by different...Ch. 12 - 11.19 Using the adeninethymine base pair in this...Ch. 12 - The partial amino acid sequence of a wild-type...Ch. 12 - 5. Thymine is usually in its normal, common form....Ch. 12 - Ultraviolet (UV) radiation is mutagenic.
What...Ch. 12 - Researchers interested in studying mutation and...Ch. 12 - The effect of base - pair substitution mutations...Ch. 12 - Prob. 9PCh. 12 - 11.10 In numerous population studies of...
Ch. 12 - 11.11 Two different mutations are identified in a...Ch. 12 - 11.22 Many human genes are known to have homologs...Ch. 12 - 11.13 Answer the following questions concerning...Ch. 12 - Prob. 14PCh. 12 - Prob. 15PCh. 12 - Prob. 16PCh. 12 - 11.15 A sample of the bacterium is exposed to...Ch. 12 - 11.16 A strain of is identified as having a null...Ch. 12 - Define gene conversion and contrast it with gene...Ch. 12 - Prob. 20PCh. 12 - Prob. 21PCh. 12 - Prob. 22PCh. 12 - Prob. 23PCh. 12 - Prob. 24PCh. 12 - 25. If homologous recombination did not occur,...Ch. 12 - In this chapter, three features of genes or of DNA...Ch. 12 - Briefly compare the production of DNA double -...Ch. 12 - During mismatch repair, why is it necessary to...Ch. 12 - 11.27 Following the spill of a mixture of...Ch. 12 - A geneticist searching for mutations uses the...Ch. 12 - A wild - type culture of haploid yeast is exposed...Ch. 12 - A fragment of a wild - type polypeptide is...Ch. 12 - Prob. 33PCh. 12 - 11.40 Common baker’s yeast () is normally grown at...Ch. 12 - 11.41 The two gels illustrated below contain...Ch. 12 - Alkaptonuria is a human autosomal recessive...Ch. 12 - 11.33 In an experiment employing the methods of...Ch. 12 - Using your knowledge of DNA repair pathways choose...Ch. 12 - 11.35 Ataxia telangiectasia is a human inherited...Ch. 12 - 40. Two haploid strains of fungus are fused to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Although A-form, B-form, and Z-form DNA are all left-handed, they exhibit different physical properties due to their different numbers of bases per turn. True Falsearrow_forwardShow the expected labeled cleavage products if the following DNA segment were subjected to each of the four cleavage reactions: 32P-A-A-C-A-T-G-G-C-G-C-T-T-A-T-G-A-C-G-Aarrow_forwardZ-DNA derives its name from the zig-zag conformation of phosphate groups. What features of the DNA molecule allow this structure to form?arrow_forward
- Single-strand binding proteins keep the two parental strands of DNA separated from each other until DNA polymerase has an opportunity to replicate the strands. Suggest how single-strand binding proteins keep the strands separated and yet do not impede the ability of DNA polymerase to replicate the strands.arrow_forwardDNA replication of the lagging strand is as a result of 2 factors. Name these (2)arrow_forwardThe ethidium bromide added to the agarose gels intercalates within the base pairs of the DNA double helix as it travels through the gel. Exposure to UV light causes the ethidium bromide to fluoresce, thus allowing for visualization of any DNA. How might this tendency of ethidium bromide to intercalate within the DNA double helix attribute to its carcinogenic properties in living organisms?arrow_forward
- Tick the correct statements: Remember: Tautomers are structural isomers that differ from each other based on the position of the proton(s) and their double bonds. ( ) The nitrogenous bases of nucleic acids, which contain heterocyclic and analogous nuclei, can adopt different tautomeric forms involving multiple H+ that are exchangeable depending on the medium. In DNA, spontaneous formation of smaller tautomers appears to contribute to mutagenic errors during DNA replication, while in RNA, they seem to be related to increased structural and functional diversity of enzymes and RNA aptamers (research this and confirm if it is false or real) ( ) in relation to the figure, anomer 1 has beta stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) in relation to the figure, anomer 1 has alpha stereochemistry with respect to the C anomeric of the pentose, and is making an N-glycosidic bond ( ) In general, in naturally occurring nucleosides,…arrow_forwardIntroduction: The enzyme deoxyribonuclease I (DNase I) is an endonuclease that hydrolyzes the phosphodiester bonds of the double-stranded DNA backbone to yield small oligonucleotide fragments. DNase I is used therapeutically to treat patients with cystic fibrosis (CF). The DNase I enzyme is inhaled into the lungs where it then acts upon the DNA contained in the viscous sputum secreted by the lungs in these patients. Hydrolysis of high molecular weight DNA to low molecular weight DNA in the sputum decreases its viscosity and improves lung function. Animal studies have shown that DNase I is also effective in treating the autoimmune disease systemic lupus erythematosus (SLE). In this disease, the DNA secreted into the serum provokes an immune response. DNase I prevents the immune response by degrading the DNA to smaller fragments that are not recognized by the immune system. Genentech, Inc., the company that produces the recombinant DNase I, was interested in improving the efficiency of…arrow_forwardIntroduction: The enzyme deoxyribonuclease I (DNase I) is an endonuclease that hydrolyzes the phosphodiester bonds of the double-stranded DNA backbone to yield small oligonucleotide fragments. DNase I is used therapeutically to treat patients with cystic fibrosis (CF). The DNase I enzyme is inhaled into the lungs where it then acts upon the DNA contained in the viscous sputum secreted by the lungs in these patients. Hydrolysis of high molecular weight DNA to low molecular weight DNA in the sputum decreases its viscosity and improves lung function. Animal studies have shown that DNase I is also effective in treating the autoimmune disease systemic lupus erythematosus (SLE). In this disease, the DNA secreted into the serum provokes an immune response. DNase I prevents the immune response by degrading the DNA to smaller fragments that are not recognized by the immune system. Genentech, Inc., the company that produces the recombinant DNase I, was interested in improving the efficiency of…arrow_forward
- Briefly discuss the pros and cons of having a nucleoid (as bacteria do) versus a double nuclear membrane surrounding the DNA (as in eukaryotes). List and explain three reasons why DNA replication is very accurate.arrow_forwardAs you should recall, DNA, when not being actively transcribed, has a double helical structure. This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein. The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template strand? ______________________________ Q: Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA: ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain: ________--________--________--________--________--________--________--________arrow_forwardThe double helical structure of DNA is intrinsically unstable and easily dissociates to form two separate strands. Why? How does this affect the two key biological functions of chromosomal DNA? What would happen if the DNA helices were too stable?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY