ORGANIC CHEMISTRY E-BOOK W/SMARTWORK5
ORGANIC CHEMISTRY E-BOOK W/SMARTWORK5
2nd Edition
ISBN: 9780393664034
Author: KARTY
Publisher: NORTON
bartleby

Concept explainers

Neutral Amino Acids
Amino acids which do not have any charge on them are neutral amino acids.
Globular Protein
The globular proteins refer to the shape of protein specifically spherical in nature apart from spherical form fibrous, disordered and membrane-bound proteins exist. These globular proteins are miscible in water and form a colloidal solution rather than …
Dimer
Dimers are basic organic compounds, which are derivates of oligomers. It is formed by the combination of two monomers which could potentially be strong or weak and in most cases covalent or intermolecular in nature. Identical monomers are called homodime…
Dipeptide
A dipeptide is considered a mixture of two distinct amino acids. Since the amino acids are distinct, based on their composition, two dipeptide's isomers can be produced. Various dipeptides are biologically essential and are therefore crucial to industry.
bartleby

Videos

Question
Book Icon
Chapter 14, Problem 14.49P
Interpretation Introduction

Interpretation:

The optimal alignment for the interaction between guanine and adenine is to be drawn. Number of hydrogen bonds in the interaction is to be determined.

Concept introduction:

The two strands are held together relatively strongly by hydrogen bonding among the nitrogenous bases. Hydrogen bond is between the hydrogen-bond donors and one hydrogen-bond acceptor. Guanine has two hydrogen bond donors and one hydrogen bond acceptor, adenine has one hydrogen bond acceptor and one hydrogen bond donor and cytosine has two hydrogen bond acceptors and one hydrogen bond donor.

Expert Solution & Answer
Check Mark

Want to see the full answer?

Check out a sample textbook solution
Blurred answer
Previous
Chapter 14, Problem 14.48P
Next
Chapter 14, Problem 14.50P
Students have asked these similar questions
Figure 14-31a (p. 716) shows how hydrogen bonding accounts for the fact that guanine is complementary to cytosine, giving rise to three simultaneous hydrogen bonds in the interaction. Draw the optimal alignment for the interaction between guanine and adenine. How many simultaneous hydrogen bonds exist in that interaction?
(i) A segment of DNA containing 20 base pairs includes 7 guanine residues. How many adenine residues are in the segment? How many uracil residues are in the segment??
a segment of dna has the following sequences of bases ATGCAATGATATTGAAGCTTA

Chapter 14 Solutions

ORGANIC CHEMISTRY E-BOOK W/SMARTWORK5

Ch. 14 - Prob. 14.1PCh. 14 - Prob. 14.2PCh. 14 - Prob. 14.3PCh. 14 - Prob. 14.4PCh. 14 - Prob. 14.5PCh. 14 - Prob. 14.6PCh. 14 - Prob. 14.7PCh. 14 - Prob. 14.8PCh. 14 - Prob. 14.9PCh. 14 - Prob. 14.10P
Ch. 14 - Prob. 14.11PCh. 14 - Prob. 14.12PCh. 14 - Prob. 14.13PCh. 14 - Prob. 14.14PCh. 14 - Prob. 14.15PCh. 14 - Prob. 14.16PCh. 14 - Prob. 14.17PCh. 14 - Prob. 14.18PCh. 14 - Prob. 14.19PCh. 14 - Prob. 14.20PCh. 14 - Prob. 14.21PCh. 14 - Prob. 14.22PCh. 14 - Prob. 14.23PCh. 14 - Prob. 14.24PCh. 14 - Prob. 14.25PCh. 14 - Prob. 14.26PCh. 14 - Prob. 14.27PCh. 14 - Prob. 14.28PCh. 14 - Prob. 14.29PCh. 14 - Prob. 14.30PCh. 14 - Prob. 14.31PCh. 14 - Prob. 14.32PCh. 14 - Prob. 14.33PCh. 14 - Prob. 14.34PCh. 14 - Prob. 14.35PCh. 14 - Prob. 14.36PCh. 14 - Prob. 14.37PCh. 14 - Prob. 14.38PCh. 14 - Prob. 14.39PCh. 14 - Prob. 14.40PCh. 14 - Prob. 14.41PCh. 14 - Prob. 14.42PCh. 14 - Prob. 14.43PCh. 14 - Prob. 14.44PCh. 14 - Prob. 14.45PCh. 14 - Prob. 14.46PCh. 14 - Prob. 14.47PCh. 14 - Prob. 14.48PCh. 14 - Prob. 14.49PCh. 14 - Prob. 14.50PCh. 14 - Prob. 14.51PCh. 14 - Prob. 14.52PCh. 14 - Prob. 14.53PCh. 14 - Prob. 14.54PCh. 14 - Prob. 14.55PCh. 14 - Prob. 14.56PCh. 14 - Prob. 14.57PCh. 14 - Prob. 14.58PCh. 14 - Prob. 14.59PCh. 14 - Prob. 14.60PCh. 14 - Prob. 14.61PCh. 14 - Prob. 14.62PCh. 14 - Prob. 14.63PCh. 14 - Prob. 14.64PCh. 14 - Prob. 14.65PCh. 14 - Prob. 14.66PCh. 14 - Prob. 14.1YTCh. 14 - Prob. 14.2YTCh. 14 - Prob. 14.3YTCh. 14 - Prob. 14.4YTCh. 14 - Prob. 14.5YTCh. 14 - Prob. 14.6YTCh. 14 - Prob. 14.7YTCh. 14 - Prob. 14.8YTCh. 14 - Prob. 14.9YTCh. 14 - Prob. 14.10YTCh. 14 - Prob. 14.11YTCh. 14 - Prob. 14.12YTCh. 14 - Prob. 14.13YT
Knowledge Booster
Background pattern image
Chemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, chemistry and related others by exploring similar questions and additional content below.
Similar questions
Recommended textbooks for you
Text book image
Chemistry: Principles and Reactions
Chemistry
ISBN:9781305079373
Author:William L. Masterton, Cecile N. Hurley
Publisher:Cengage Learning
Text book image
Introductory Chemistry: An Active Learning Approa...
Chemistry
ISBN:9781305079250
Author:Mark S. Cracolice, Ed Peters
Publisher:Cengage Learning
Text book image
Introduction to General, Organic and Biochemistry
Chemistry
ISBN:9781285869759
Author:Frederick A. Bettelheim, William H. Brown, Mary K. Campbell, Shawn O. Farrell, Omar Torres
Publisher:Cengage Learning
Text book image
Organic And Biological Chemistry
Chemistry
ISBN:9781305081079
Author:STOKER, H. Stephen (howard Stephen)
Publisher:Cengage Learning,
Text book image
General, Organic, and Biological Chemistry
Chemistry
ISBN:9781285853918
Author:H. Stephen Stoker
Publisher:Cengage Learning
Text book image
Organic Chemistry
Chemistry
ISBN:9781305580350
Author:William H. Brown, Brent L. Iverson, Eric Anslyn, Christopher S. Foote
Publisher:Cengage Learning
SEE MORE TEXTBOOKS
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY