Biology 2e
2nd Edition
ISBN: 9781947172517
Author: Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 26CTQ
Chronic lymphocytic leukemia patients often harbor nonsense mutations in their spliceosome machinery. Describe how this mutation of the spliceosome would change the final location and sequence of a pre-mRNA.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Explain why the translation of a given mRNA can be inhibited by a segment of its complementary sequence, a so-called antisense RNA.
What are the “protein synthesis factories?” Give an overview of the relationship between these “factories” and mRNA to explain why they are called the “protein synthesis factories.
Indicate the amino acids that would appear in the protein produced by translation of this mRNA sequence
Chapter 15 Solutions
Biology 2e
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
A new landowner has a triangular piece of flat land she wishes to fence. Starting at the west corner, she measu...
College Physics
Which of the following factors would tend to increase membrane fluidity? A. a greater proportion of unsaturated...
Campbell Biology in Focus (2nd Edition)
Match the following examples of mutagens. Column A Column B ___a. A mutagen that is incorporated into DNA in pl...
Microbiology: An Introduction
Fibrous connective tissue consists of ground substance and fibers that provide strength, support, and flexibili...
Human Biology: Concepts and Current Issues
1. Write a single sentence, using no more than 25 words, to summarize each of the following cellular processes...
Human Anatomy & Physiology
Distinguish between microevolution, speciation, and macroevolution.
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural differences.arrow_forwardWhy mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of this difference?arrow_forwardAminoacyl-tRNA synthetases are the only component of gene expression that decodes the genetic code. Explain.arrow_forward
- "Removing introns from pre-mRNA can result in different gene variants”- Briefly explain this statement at your own words.arrow_forwardReferring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′arrow_forwardThe diagram shows a pre-mRNA before splicing and processing. In this cell type, a protein is present that binds to the 3' splice site of intron 2, such that the spliceosome cannot bind here. What components of this transcript will be retained and removed in the spliced mRNA?arrow_forward
- The animated figure below shows formation of the lariat during mRNA splicing. Consider this figure as you answer the following question.arrow_forwardGiven the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptidarrow_forwardIndicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’arrow_forward
- Shown below is the 5' end of an mRNA molecule. What are the first three (N-terminal) amino acids of its protein product? 5'-AUGUGUUGAUGUAUCAGACCUGUC ---arrow_forwardexplain as you would to a 12th grader why it is necessary for introns to be spliced from pre-mRNAs.arrow_forwardWe have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY