Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 16, Problem 27P
Summary Introduction
a.
To determine:
The technique which can be used to identify specific miRNA that might be associated with the discovery of the protein.
Introduction:
miRNA refers to non-coding RNA that play a major role in the regulation of gene expression. Different techniques can be used to detect specific miRNA that is associated with a particular protein molecule.
Summary Introduction
b.
To determine:
The ways by which mutant mouse can be used to identify the mRNA that might be targeted by the miRNA- RISC complexes containing Argonaute like protein.
Introduction:
The human genome contains 1000 genes encoding the miRNAs. The miRNAs become incorporated into ribonucleoprotein complexes called miRNA induced silencing complexes.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Consider the now dominant variant of the SARS-CoV-2 called the D614G mutation:
a) The mutation changes an Aspartate (D, Asp) to a Glycine (G, Gly) at nucleotide position 614 (that’s why it’s called the D614G mutant) in the S1 subunit of the Spike protein. Using only the information above and a codon table, what are the mRNA codon sequences of the 2019-dominant and 2020-dominant Spike proteins? Note the figure above is not needed toanswer the question. Report in 5’ to 3' orientation __________________________________________
b) What type of substitution is this? In your answer, address the following: • The expected substitution in base sequence (e.g., A à C)• If the mutation is synonymous, nonsynonymous, or a frameshift• If the mutation is a transition or a transversion
c) The mutation increases infectivity by reducing the stability of the Spike protein such that it can remain in the open conformation more often. The open conformation increases the chances of binding to the host ACE2…
(b)
Hemoglobin is made of B-globin subunits. The first few mRNA nucleotides for B-
globin are given by:
(1)
(iii)
(iv)
Write down the DNA sequence that has led to this mRNA and indicate the
sense and non-sense strands and the polarity.
CE
Derive the polypeptide for the sequence using the table of the genetic code
(Table Q1 below) and indicate the polarity of the polypeptide chain.
First
Position
(5' end)
U
A single point mutation in mRNA sequence can cause sickle cell anemia by
changing the amino acid Glu to Val. For the given mRNA, indicate the point
mutations for the first Glu in the polypeptide sequence that can cause this
disease.
5'-AUGGUCCACCUGACUCCUGAGGAGAAG...UGA-3'
C
The polypeptide of B-globin contains the amino acid Leu. Write down all the
anticodons of the tRNA molecules that can potentially code for Val. Indicate
the polarity of the anti-codon.
A
G
Table 1. The Codons of the Genetic Code
Second Position
U
Phe
Phe
Leu
Leu
Leu
Leu
Leu
Leu
Ile
Ile
Ile
Met-Start
Val
Val
Val…
Consider the following mRNA base sequence
5' CUG-CAC 3'
(a) What dipeptide is coded for by this mRNA?
(b) What dipeptide is formed if a mutation converts CUG to CUU?
(c) What dipeptide is formed if a mutation converts CAC to CGC?
(d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
Chapter 16 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 16 - For each of the terms in the left column, choose...Ch. 16 - Does each of the following types of gene...Ch. 16 - List five events other than transcription...Ch. 16 - Which eukaryotic RNA polymerase RNA pol I, pol II,...Ch. 16 - You have synthesized an enhancerless GFP reporter...Ch. 16 - Prob. 6PCh. 16 - Yeast genes have cis-acting elements upstream of...Ch. 16 - A single UASG regulates the expression of three...Ch. 16 - Prob. 9PCh. 16 - a. Assume that two transcription factors are...
Ch. 16 - a. You want to create a genetic construct that...Ch. 16 - In Problem 12, you identified a genomic region...Ch. 16 - Prob. 13PCh. 16 - Prob. 14PCh. 16 - Genes in both prokaryotes and eukaryotes are...Ch. 16 - Prob. 16PCh. 16 - Prader-Willi syndrome is caused by a mutation in...Ch. 16 - The human IGF-2R gene is autosomal and maternally...Ch. 16 - Follow the expression of a paternally imprinted...Ch. 16 - Reciprocal crosses were performed using two inbred...Ch. 16 - Interestingly, imprinting can be tissue-specific....Ch. 16 - Prob. 22PCh. 16 - a. How can a single eukaryotic gene give rise to...Ch. 16 - A hunchback gene, a gene necessary for proper...Ch. 16 - You know that the mRNA and protein produced by a...Ch. 16 - You are studying a transgenic mouse strain that...Ch. 16 - Prob. 27PCh. 16 - Scientists have exploited the siRNA pathway to...Ch. 16 - Researchers know that Fru-M controls male sexual...Ch. 16 - The Drosophila gene Sex lethal Sxl is deserving of...Ch. 16 - Prob. 31P
Knowledge Booster
Similar questions
- Genes can be transcribed into mRNA, in the case of protein coding genes, or into RNA, in the case of genes such as those that encode ribosomal or transfer RNAs. Define a gene. For the following characteristics, state whether they apply to (a) continuous, (b) simple, or (c) complex transcription units.i. Found in eukaryotesii. Contain intronsiii. Capable of making only a single protein from a given genearrow_forwardExplain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwarda) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forward
- Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that is coded for.5′...GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG...3′arrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forwardMicroRNAs are small RNA molecules that bind to the 3′ end of mRNA and suppress translation . Some eukaryotic mRNAs have internal ribosome-binding sites downstream of the 5′ cap, where ribosomes normally bind. In one investigation, miRNAs did not suppress translation by ribosomes that had attached to internal ribosomebinding sites ). What does this finding suggest about how miRNAs suppress translation?arrow_forward
- We have a eukaryotic full-length mRNA molecule consisting of 33 bp5ʹ -... ACGAUACGUAUGCUCGAGAUCCGAGACUAUGUU ...- 3ʹ a) What are the first five amino acids that are translated? b) Describe how the ribosome finds the translation start on the mRNA transcript from prokaryotic and eukaryotic genes, respectively.arrow_forwardUsing the transcription unit diagrammed below, in which exons are represented by blue boxes and introns are represented by the connecting lines. You discover a single base deletion in region E of this DNA sequence. Regarding transcription, this mutation will likely: 1.) Result in an alteration to the mRNA sequence. 2.)Have no effect on transcription or the mRNA sequence 3.)Prevent transcription at the TATAA box 4.) Result in an increase or decrease in the amount of mRNA transcribedarrow_forwardif a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV data showed that it contains 0.67 % Tyrosine amino acid by weight. How many Tyrosine amino acids this protein contain? If this protein that was formed contains a total of 865 amino acids long, how many nucleic acids are there in the mRNA including the initiator and the terminator codons?arrow_forward
- Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forwardHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect might this new stop codon have on the primary and tertiary levels of the mutant factor IX protein (compared to the native or wild-type protein).arrow_forwardmiRNAs target endogenous mRNAs in a sequence-specific manner. Explain, conceptually, how one might identify potential mRNA targets for a given miRNA if you only know the sequence of the miRNA and the sequence of all mRNAs in a cell or tissue of interest.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education