Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 20P
Reciprocal crosses were performed using two inbred strains of mice, AKR and PWD, that have different alleles of many polymorphic loci. In each of the two crosses, placental tissue was isolated whose origin was strictly from the fetus (this can be separated by dissection from placental tissue originating from the mother). RNA was prepared from the fetal placental tissue and then subjected to “deep sequencing” (that is, RNA-Seq). Because of the polymorphisms, investigators could compare the number of “reads” of mRNAs for specific genes that were transcribed from maternal or paternal alleles, as shown in the following figure. (The x-axis shows the percentage of reads for the given mRNA that correspond to the AKR allele of that gene.)
| a. | Which of the genes (A, B, or C) is maternally imprinted? Which is paternally imprinted? Which is not imprinted? |
| b. | Why was it important to perform reciprocal crosses to determine whether any of the genes were imprinted? |
| c. | Using the same type of diagram that indicates the percentage of AKR alleles, diagram the expected results for these same three genes if a female F mouse from the cross on the left (that is, a daughter of a cross between an AKR female and a PWD male) was then crossed to a PWD male. Describe the two possible outcomes for each gene. |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
T. Miyake and M. Demerec examined proline-requiring mutations in the bacterium Salmonella typhimurium (). On the basis of complementation testing, they found four proline auxotrophs: proA, proB, proC, and proD. To determine whether proA, proB, proC, and proD loci were located close together on the bacterial chromosome, they conducted a transduction experiment. Bacterial strains that were proC+ and had mutations at proA, proB, or proD were used as donors. The donors were infected with bacteriophages, and progeny phages were allowed to infect recipient bacteria with genotype proC− proA+ proB+ proD+. The recipient bacteria werethen plated on a selective medium that allowed only proC+ bacteria to grow. After this, the proC+ transductants were plated on selective media to reveal their genotypes at the other three pro loci. The following results were obtained:
Q.Which genotypes represent single transductants and which represent cotransductants?
T. Miyake and M. Demerec examined proline-requiring mutations in the bacterium Salmonella typhimurium (). On the basis of complementation testing, they found four proline auxotrophs: proA, proB, proC, and proD. To determine whether proA, proB, proC, and proD loci were located close together on the bacterial chromosome, they conducted a transduction experiment. Bacterial strains that were proC+ and had mutations at proA, proB, or proD were used as donors. The donors were infected with bacteriophages, and progeny phages were allowed to infect recipient bacteria with genotype proC− proA+ proB+ proD+. The recipient bacteria werethen plated on a selective medium that allowed only proC+ bacteria to grow. After this, the proC+ transductants were plated on selective media to reveal their genotypes at the other three pro loci. The following results were obtained:
Q.Is there evidence that proA, proB, and proD are located close to proC? Explain your answer.
What is a recombinant vector? How is a recombinant vector constructed? Explain how X-Gal is used in a method of identifying recombinant vectors that contain segments of chromosomal DNA.
Chapter 16 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 16 - For each of the terms in the left column, choose...Ch. 16 - Does each of the following types of gene...Ch. 16 - List five events other than transcription...Ch. 16 - Which eukaryotic RNA polymerase RNA pol I, pol II,...Ch. 16 - You have synthesized an enhancerless GFP reporter...Ch. 16 - Prob. 6PCh. 16 - Yeast genes have cis-acting elements upstream of...Ch. 16 - A single UASG regulates the expression of three...Ch. 16 - Prob. 9PCh. 16 - a. Assume that two transcription factors are...
Ch. 16 - a. You want to create a genetic construct that...Ch. 16 - In Problem 12, you identified a genomic region...Ch. 16 - Prob. 13PCh. 16 - Prob. 14PCh. 16 - Genes in both prokaryotes and eukaryotes are...Ch. 16 - Prob. 16PCh. 16 - Prader-Willi syndrome is caused by a mutation in...Ch. 16 - The human IGF-2R gene is autosomal and maternally...Ch. 16 - Follow the expression of a paternally imprinted...Ch. 16 - Reciprocal crosses were performed using two inbred...Ch. 16 - Interestingly, imprinting can be tissue-specific....Ch. 16 - Prob. 22PCh. 16 - a. How can a single eukaryotic gene give rise to...Ch. 16 - A hunchback gene, a gene necessary for proper...Ch. 16 - You know that the mRNA and protein produced by a...Ch. 16 - You are studying a transgenic mouse strain that...Ch. 16 - Prob. 27PCh. 16 - Scientists have exploited the siRNA pathway to...Ch. 16 - Researchers know that Fru-M controls male sexual...Ch. 16 - The Drosophila gene Sex lethal Sxl is deserving of...Ch. 16 - Prob. 31P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- ISSR is generally a dominant STS DNA marker. Nonetheless, with validated experimental evidence (e.g. laboratory and population genetics data), the marker can be used in codominance marker genotyping. Briefly explain each case below: a) Codominant marker targets specific locus and reveals allelic variations in that locus among DNA samples. b) Dominant marker: primers can complement other repeat sequences or in multiple loci thereby non-specificity in sampled genomes.arrow_forwardNot all inherited traits are determined by nuclear genes (i.e., genes located in the cell nucleus) that are expressed during the life of an individual. In particular, maternal effect genes and mitochondrial DNA are notable exceptions. With these ideas in mind, let’s consider the cloning of a sheep (e.g., Dolly). A. With regard to maternal effect genes, is the phenotype of such a cloned animal determined by the animal that donated the enucleatedegg or by the animal that donated the somatic cell nucleus? Explain.arrow_forwardDuring construction of a knockout mouse, a targeting vector is introduced into mouse embryonic cells, where it integrates into the genome at a ["targeted site", "random location"] by ["homologous recombination", "nonhomologous end joining "] . Pick answers within quotation marks to fill in the blanks.arrow_forward
- When a genome is edited using the CRISPR/Cas9 system, a knockout allele can be produced if DNA is repaired by ["homologous recombination", "base excision repair", "nucleotideexcision repair", "nonhomologous end joining"] , and a knockin allele will result if DNA is repaired by ["base excision repair", "homologous recombination", "nonhomologous end joining", "nucleotide excision repair"] . Pick the correct answers within the quotation marks to fill in the blank.arrow_forwardTraditional Sanger sequencing has largely been replaced in recent years by next-generation and third-generation sequencing approaches. Describe advantages of these sequencing methods over first-generation Sanger sequencing.arrow_forwardFollowing a dye terminator DNA sequencing reaction using 2',3'-dideoxynucleotide triphosphates (ddNTP's), separation of the primer reaction products was achieved using capillary gel electrophoresis. In the following example, ddATP was labeled with a 'green' fluorophore, ddTTP was labeled with 'red', ddCTP was labeled with 'black', and ddGTP was labeled with 'blue. From left to right (i.e., the shortest to longest retention time), the sequence was: AACGGTTGTCTCTGATTTGTATTATGTT. What is the sequence of the template DNA, from its 3' to 5' end? о ТTIGCCAACAGAGACTAAACATААТАСАА O TTGTATTATGTTTAGTCTCTGTTGGCAA О ААСАТААТАСАААТСAGAGAСAАССGTT O AACGGTTGTCTCTGATTTGTATTATGTTarrow_forward
- The DNA of every individual in the pedigree shown in image B (below) has been sequenced at the causative locus, all the non-shaded individuals are wild type apart from III.1 and III.6. III.1 and III.6 have both been proven to have the causative allele for the condition but they do not exhibit any of the phenotypic signs or symptoms. Based on this pedigree, what is the level of penetrance for the condition? Please give your answer as a percentage to one decimal place, give the number only, no percentage symbol. Given the information above I calculate the level of penetrance seen in image B to be "Blank" 1 percent.arrow_forwardThe DNA of every individual in the pedigree shown in image B (below) has been sequenced at the causative locus, all the non- shaded individuals are wild type apart from III.1 and III.6. III.1 and III.6 have both been proven to have the causative allele for the condition but they do not exhibit any of the phenotypic signs or symptoms. Based on this pedigree, what is the level of penetrance for the condition? Please give your answer as a percentage to one decimal place, give the number only, no percentage symbol. ANSWER: Given the information above I calculate the level of penetrance seen in image B to be Blank 1 percent. A KEY Homozygous Homozygous Heterozygous Heterozygous Wild Type Male Female Male Female Male Note: Completely red symbol denotes an individual exhibiting the phenotype of interest CI || III IV V 1/4 1/2 1/2 1/2 1/2 Wild Type Female 1/4 1/2 Affected Known carrier Affected female Normal female Affected male Normal male D ●●●arrow_forwardTwo homologous chromosomes in ES cells are depicted below with the portion of your gene of interest that you target with the CRISPR/Cas9 method. Proposed cleavage sites of Cas9 are shown with arrows. The schematic can also be found at this link. (1) (ii) Maternal Chromosome 1 Maternal Chromosome 1 Paternal Paternal Chromosome 1 Chromosome 1 Maternal Maternal Chromosome 1 Chromosome 1 Paternal Paternal Chromosome 1 Chromosome 1 Which schematic (i-iv) above correctly portrays the action of Cas9? O (iii) O (iv) O (i) O (ii) * (iii) (iv)arrow_forward
- F ′strains in E. coli are derived from Hfr strains. In some cases, these F ′strains show a high rate of integration back into the bacterial chromosome of a second strain. Furthermore, the site of integration is often the site occupied by the sex factor in the original Hfr strain (before production of the F ′strains). Explain these results.arrow_forwardHow can you assess dominance and mapping with only one mutant?arrow_forwardA person with a rare genetic disease has a sample of her chromosomessubjected to in situ hybridization using a probe that is known to recognize band p11 on chromosome 7. Even though her chromosomes look cytologically normal, the probe does not bind to this person’s chromosomes. How would you explain these results? How would you use this information to positionally clone the gene that is related to this disease?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License