Genetics: From Genes to Genomes, 5th edition
5th Edition
ISBN: 9780073525310
Author: Leland H. Hartwell, Michael L. Goldberg, Janice A. Fischer, Leroy Hood, Charles F. Aquadro
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16, Problem 5P
You have synthesized an “enhancerless” GFP reporter gene in which the jellyfish GFP gene is placed downstream of a basal promoter that functions in mice. You will now fuse this enhancerless reporter to the three types of sequences listed below (x–z).
| a. | Which of the three types of sequences would you use for which of the three listed purposes (i–iii)? In each case, explain how the particular fusion would address the particular use. |
Types of sequences fused to the reporter:
| x. | random mouse genome sequences |
| y. | known mouse kidney-specific enhancer |
| z. | fragments of genomic DNA surrounding the transcribed part of a mouse gene |
Uses:
| i. | to identify a genes’ enhancer(s) |
| ii. | to express GFP tissue-specifically |
| iii. | to identify genes expressed in neurons |
| b. | Which of the sequences (x–z) would you fuse to a particular mouse gene of interest in order to express the protein product of the gene “ectopically”, that is, in a tissue in which the gene is not usually expressed? Why might you want to do this experiment in the first place? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The sequence of the lac promoter and two mutant promoters (Mutn 1 and Mutn 2) are shown below. The
activity of these promoters is measured by fusing the them to the gene for Green Fluorescent Protein
(GFP) and measuring the production of green fluorescence by GFP protein. What would you expect the
GFP signal to be higher, lower or same for mutant promoters.
Mutn 1 (enter higher, lower or same)
Mutn 2 (enter higher, lower or same)
- 42
?
?
+1
Lac
CCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
CCAGGCTTAAAACTTTATGCTTCCGGCTCGTATGTTGTGTGGA
Lac Mutl
Lac Mut 2 CCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGA
Describe the difference between a transcriptional fusion and a translational reporter gene fusion. What sequences should you include in each? What types of information can be garnered from their analyses?
Please include annotated pictures of the reporter gene expression patterns.
a) The best vector to use determine receptor binding protein expression would have been one with a GFP gene (green flourescent protein) attached. State one (1) reason why including this gene would have made the experiment easier and whether you have inserted the receptor binding domain gene before or after the GFP gene.
b) You wish to determine the sucess pf your transformation by detecting the presence of receptor binding domian mRNA. Describe the key steps of the hybrdization technique you would use, clearly stating how you would design the probe to detect your receptor mRNA.
Chapter 16 Solutions
Genetics: From Genes to Genomes, 5th edition
Ch. 16 - For each of the terms in the left column, choose...Ch. 16 - Does each of the following types of gene...Ch. 16 - List five events other than transcription...Ch. 16 - Which eukaryotic RNA polymerase RNA pol I, pol II,...Ch. 16 - You have synthesized an enhancerless GFP reporter...Ch. 16 - Prob. 6PCh. 16 - Yeast genes have cis-acting elements upstream of...Ch. 16 - A single UASG regulates the expression of three...Ch. 16 - Prob. 9PCh. 16 - a. Assume that two transcription factors are...
Ch. 16 - a. You want to create a genetic construct that...Ch. 16 - In Problem 12, you identified a genomic region...Ch. 16 - Prob. 13PCh. 16 - Prob. 14PCh. 16 - Genes in both prokaryotes and eukaryotes are...Ch. 16 - Prob. 16PCh. 16 - Prader-Willi syndrome is caused by a mutation in...Ch. 16 - The human IGF-2R gene is autosomal and maternally...Ch. 16 - Follow the expression of a paternally imprinted...Ch. 16 - Reciprocal crosses were performed using two inbred...Ch. 16 - Interestingly, imprinting can be tissue-specific....Ch. 16 - Prob. 22PCh. 16 - a. How can a single eukaryotic gene give rise to...Ch. 16 - A hunchback gene, a gene necessary for proper...Ch. 16 - You know that the mRNA and protein produced by a...Ch. 16 - You are studying a transgenic mouse strain that...Ch. 16 - Prob. 27PCh. 16 - Scientists have exploited the siRNA pathway to...Ch. 16 - Researchers know that Fru-M controls male sexual...Ch. 16 - The Drosophila gene Sex lethal Sxl is deserving of...Ch. 16 - Prob. 31P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Another mutant for of the Lac promoter demonstrates the characteristics below compared to the wild-type promoter. The RNA Polymerase Holoenzyme binds tighter to the mutant promoter, but has reduced promoter activity in an assay with the promoter fuse to the gene for Green Fluorescent Protein (GFP). Provide a plausible explanation for this data. Lac Promoter Activity punog Binding of RNA Pol Holoenzymes to Promoters 120 100 80 60 40 20 0 0 20 40 Lac Promoter X 60 [DNA] nM 80 100 120 GFP Fluorecence 100 90 80 70 60 50 40 30 20 10 0 Lac Promoter Xarrow_forwardYou have synthesized an enhancerless GFP reportergene in which the jellyfish GFP cDNA is placeddownstream of a basal promoter that functions inmice. You will now fuse this enhancerless reporter tothe three types of sequences listed below (x–z).a. Which of the three types of sequences would youuse for which of the three listed purposes (i–iii)? Ineach case, explain how the particular fusion wouldaddress the particular use.Types of sequences fused to the reporter:x. random mouse genome sequencesy. known mouse kidney-specific enhancerz. fragments of genomic DNA surroundingthe transcribed part of a mouse geneUses:i. to identify a gene’s enhancer(s)ii. to express GFP tissue-specificallyiii. to identify genes expressed in neuronsb. Which of the sequences (x–z) would you fuse to aparticular mouse gene of interest in order to express the protein product of the gene ectopically,that is, in a tissue in which the gene is not usuallyexpressed? Why might you want to do this experiment in the first…arrow_forwardRecombinant expression in prokaryotic systems has numerous advantages when compared to eukaryotic systems, one of which is the ability to produce the protein of interest at high levels. For this, it is essential to use strong promoters and genetically modified bacteria capable of overexpressing the exogenous gene. Therefore, mark the alternative that best represents the set of bacterial promoters/strains for protein overexpression. * A)use of the T7 promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli strain BL21DE3. B)use of the T7 promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli DH5 strain. C)use of the lac promoter, whose induction occurs by the addition of IPTG in the culture medium, and use of the Escherichia coli DH5 strain. D) use of the constitutive trp promoter, whose induction occurs by the addition of the amino acid Tryptophan in the medium, and use of…arrow_forward
- You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you introduce the nucleotide sequence encoding the NLS into the gene that encodes the cytoplasmic protein of interest. a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain. 5' 3' b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of the protein, at which location (A-E) should the NLS be inserted? Briefly explain. A TATAA ATATT promoter +1 B ATG TAC D TAA ATT stop codon E 3' 5'arrow_forwardTrinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.arrow_forwardThe chart below is a position specific scoring matrix (PSSM, a logarithmic transformed matrix) for a transcription factor binding site. (1). Evaluate a sequence “GACATTCA” to find out which segment of the sequence fits the binding site best. (2) What is the max score that a sequence can have with this PSSM? (3) What is the minimum score a sequence can have with this PSSM?arrow_forward
- Please answer botharrow_forwardSeveral DNA coding for different proteins, CRISPR, or siRNAs against different genes were expressed in cultured normal human somatic cells (A–G; “-” = control: no expression of exogenous gene/siRNA). The cells were either untreated (-) or irradiated to induce DNA damage (+). After 24 hours, the cells were harvested for preparing cell-free extracts. Different proteins were then detected using SDS-PAGE followed by Western blotting. These include p53, the phosphorylated form of pRb as well as total pRb, the phosphorylated form of lamin B as well as total lamin B, and caspase 3 (note that the darkness of the bands roughly corresponds to the intensity of the bands in the Western blot). Fig.1. The cells were also analysed using flow cytometry. The x-axis is DNA contents (2N represents the position of DNA as in G1 phase; 4N represents the position of DNA as in G2/M phase); the y-axis is the accumulated cell number. Fig.2. (1) The first four samples are known (the rest, see below, are all…arrow_forwardPlease express the following in detailarrow_forward
- Negative supercoiling of DNA favors the transcription of genes because it facilitates unwinding. However, not all promoter sites are stimulated by negative supercoiling. The promoter site for topoisomerase II itself is a noteworthy exception. Negative supercoiling decreases the rate of transcription of this gene. Propose a possible mechanism for this effect and suggest a reason why it may occur.arrow_forwardYou made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…arrow_forwardWhy is it adaptive for the structural genes for using lactose to be under the control of a single promoter (i.e., synthesize a polycistronic message rather than three monocistronic messages)? a. For efficient absorption and catabolism of lactose, structural genes send a single signal. This is why polycistronic message is favored more than the monocistronic message since the former involves transmission of numerous messages in initiation and termination. b. Polycistronic message is favored more than the monocistronic message. c. Polycistronic message is favored more than the monocistronic message since the former involves transmission of numerous messages in initiation and termination. d. For an efficient absorption and catabolism of lactose, structural genes send a single signal only. e. Polycistronic message is favored more than the monocistronic message since the former involves transmission of single message in initiation and termination.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license