The way by which the antibodies (that bind specifically to DNA fragments containing 5-methylcytosine, but not to DNA lacking modified nucleotide ) can be used in conjunction with the ChIP-Seq technique in the given figure to look for imprinted genes in the human genome. Introduction: The antibody or immunoglobin is a protein which is used by the immune system to neutralize or destroy the pathogen. It is produced by plasma cells of the body. A ChIp seq (ChIP-sequencing) is a technique used to analyze the interaction of proteins.

Question

Want to see the full answer?

Answer 1

Question

Chapter 16, Problem 22P

Summary Introduction

To determine:

The way by which the antibodies (that bind specifically to DNA fragments containing 5-methylcytosine, but not to DNA lacking modified nucleotide) can be used in conjunction with the ChIP-Seq technique in the given figure to look for imprinted genes in the human genome.

Introduction:

The antibody or immunoglobin is a protein which is used by the immune system to neutralize or destroy the pathogen. It is produced by plasma cells of the body. A ChIp seq (ChIP-sequencing) is a technique used to analyze the interaction of proteins.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…

Bacteriophage P22 was used in generalised transduction experiments to infect the Salmonella typhimurium donor strains described in the table below. The resulting phage lysates were then used to infect the recipient strains of S. typhimurium recipient strains listed in the table. In each cross, a phenotype was selected for one of the selected for one of the three genetic markers studied (str, aceA, thrA), and were made to select the recombinants corresponding to the other two markers. markers. The results are given in the following table: Strain I donor str thrA aceA thrA str aceA+ Strain recipient strs thrA+ aceA thrA str aceA Phenotype selected Str Ace+ Str recombinants selected ThrA ThrA ThrA ThrA Ace Ace Number 60 40 95 5 10 90 str: gene involved in streptomycin resistance, aceA: gene involved in the use of acetate as a carbon source, thrA: gene involved in threonine biosynthesis. 1) What are the selective media used in these three transduction experiments? to obtain the selected…

A research group is studying a bacterium X that binds to mucosal cells in the lung and invades. Wildtype X has an LD50 value of 10 bacteria when administered to mice by inhalation. Using transposon mutagenesis, the researchers have isolated two mutants of X that they call Xmut1 and Xmut2, both of which have LD50 values of 105 when inhaled by mice. However, in tissue culture cells, Xmut1 can invade the cells just as well as wild-type X, while Xmut2 cannot. Provide a possible explanation for these results.