Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18, Problem 31RQ
Summary Introduction
To review:
The steps in the processing of eukaryotic mRNA (messenger ribonucleic acids) precursor to its functional form.
Introduction:
Prokaryotic mRNAs require little or no processing;however, eukaryotic mRNAs require processing. These processing events initiate after transcription initiation. The nascent transcripts are known as pre-mRNAs.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Topic is central dogma of molecular biology
Question:
4. Assuming the translation product is an enzyme, explain its role in the final expression of a phenotype.
Please explain it to me thank you
Posttranslational processing enzymes may cleave a____________ or add chemical constituents to it
Question 2:
Part a: Complete the table describing different components of intron removal from mRNA. Nu:, X and Y refer to B-type chemistry shown on the previous page. (YELLOW table shown)
Part b: Complete the table describing different components of group I self-splicing intron removal from 26S rRNA in Tetrahymena. (BLUE table shown)
Part c: Draw the intron with an all atom structure for Branchpoint A after intron removal from mRNA
Part d: Draw the Group I self-splicing intron with an all atom structure for the Guanosine cofactor after intron removal from 26S rRNA in Tetrahymena.
Chapter 18 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 18 - Prob. 1QCh. 18 - Prob. 2QCh. 18 - Prob. 3QCh. 18 - Prob. 4QCh. 18 - Prob. 5QCh. 18 - Prob. 1RQCh. 18 - Prob. 2RQCh. 18 - Prob. 3RQCh. 18 - Prob. 4RQCh. 18 - Prob. 5RQ
Ch. 18 - Prob. 6RQCh. 18 - Prob. 7RQCh. 18 - Prob. 8RQCh. 18 - Prob. 9RQCh. 18 - Prob. 10RQCh. 18 - Prob. 11RQCh. 18 - Prob. 12RQCh. 18 - Prob. 13RQCh. 18 - Prob. 14RQCh. 18 - Prob. 15RQCh. 18 - Prob. 16RQCh. 18 - Prob. 17RQCh. 18 - Prob. 18RQCh. 18 - Prob. 19RQCh. 18 - Prob. 20RQCh. 18 - Prob. 21RQCh. 18 - Prob. 22RQCh. 18 - Prob. 23RQCh. 18 - Prob. 24RQCh. 18 - Prob. 25RQCh. 18 - Prob. 26RQCh. 18 - Prob. 27RQCh. 18 - Prob. 28RQCh. 18 - Prob. 29RQCh. 18 - Prob. 30RQCh. 18 - Prob. 31RQCh. 18 - Prob. 32RQCh. 18 - Prob. 33RQCh. 18 - Prob. 34RQCh. 18 - Prob. 35RQCh. 18 - Prob. 36RQCh. 18 - Prob. 37RQCh. 18 - Prob. 38RQCh. 18 - Prob. 39RQCh. 18 - Prob. 40RQCh. 18 - Prob. 41RQCh. 18 - Prob. 42RQCh. 18 - Prob. 43RQCh. 18 - Prob. 44RQCh. 18 - Prob. 45RQCh. 18 - Prob. 46RQCh. 18 - Prob. 47FBCh. 18 - Prob. 48FBCh. 18 - Prob. 49FBCh. 18 - Prob. 50FBCh. 18 - Prob. 51FBCh. 18 - Prob. 52FBCh. 18 - Prob. 53FBCh. 18 - Prob. 54FBCh. 18 - Prob. 55FBCh. 18 - Prob. 56FBCh. 18 - Prob. 57SACh. 18 - Prob. 58SACh. 18 - Prob. 59SACh. 18 - Prob. 60SACh. 18 - Prob. 61SACh. 18 - Prob. 62TQCh. 18 - Prob. 63TQCh. 18 - Prob. 64TQCh. 18 - Prob. 65TQCh. 18 - Prob. 66TQCh. 18 - Prob. 67TQCh. 18 - Prob. 68TQCh. 18 - Prob. 69TQCh. 18 - Prob. 70TQCh. 18 - Prob. 71TQCh. 18 - Prob. 72TQCh. 18 - Prob. 73TQCh. 18 - Prob. 74TQCh. 18 - Prob. 75TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- As we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion What experimental information verifies that certain codonsin mRNA specify chain termination during translation?arrow_forwardWhat is meant by the degeneracy of the genetic codearrow_forwardHello , please help me with this question. I am struggling with naming the Amino Acid sequence from the RNA sequence . thank you ,arrow_forward
- Question 14 A large RNA–protein complex responsible for RNA splicing is called: Question 14 options: Spliceosome Splicing complex Exon-intron processor Transcription complex Question 15 Shortly after transcriptional initiation by RNA polymerase II, a methylated nucleoside (7-methylguanosine, m7G) is added and linked by a 5′–5′ phosphodiester bond to the first 5′ nucleotide, What is this process called? Question 15 options: 3' Capping 5' Capping Polyadenylation Splicing Question 16 During polyadenylation, the RNA is cleaved at a specific site. The site is: Question 16 options: 15–30 nucleotides downstream of the AAUAAA sequence 15–30 nucleotides upstream of the AAUAAA sequence at AAUAA sequence At…arrow_forwardKindly help, I don't understand this topic :(( In each of the following DNA sequences, write the contesponding mRNA transcript right beside the item we the item and use the genetic code to determine the resulting amino acid sequence. You may proceed even without the start codon 1. TTTTACCATCCCACAATTTA 2 ACTACTTTCAGAGCTATATTCAG 3. CATTACGGAGCCTGATGCACTTAC 4. TACGCCGCAACTCCGTATGGO 5. Garg-CTACAGCCCTAGCATTTACCCGarrow_forwardQUESTION NO. 1 Fragile X syndrome is a common form of inherited mental retardation. The mutation in the disease allows the increase of a CGG repeat in a particular gene from a normal of about 30 repeats to 200-1000 repeats. This repeat is normally found in the 5' untranslated region of a gene for the protein FMR1. FMR1 might be involved in the translation of brain-specific mRNAs during brain development. The consequence of the very large number of CGG repeats in the DNA is extensive methylation of the entire promoter region of the FMR1 gene. Methylation of bases in DNA usually A. facilitates the binding of transcription factors to the DNA. B. makes a difference in activity only if it occurs in an enhancer region. C. prevents chromatin from unwinding. D. inactivates DNA for transcription. E. results in increased production of the produce of whatever gene is methylated.QUESTION NO. 2 The best definition of an endonuclease is that it hydrolyzes A. nucleotide from…arrow_forward
- True or False: there are three different start codons in the genetic codearrow_forwardAs we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion How do we know, based on studies of Neurospora nutritionalmutations, that one gene specifies one enzyme?arrow_forwardWhat are histone acetyltransferase (HAT) enzymes ?arrow_forward
- Question 1. Suppose that the diagram below represents the genomic organization of an enzyme involved in eye pigment production in mice. Within the gene are four exons. Biochemical analysis has revealed that the active site of the enzyme is located in the C terminus of the protein. The nucleotide length of each exon and intron is shown. The dinucleotide sequence GT represents the 5’ splice site and the dinucleotide sequence AG represents the 3’ splice site. Both the 5’ and the 3’ splice sites must be present for splicing to occur. Assume that the first and second stop codons are located immediately after the first and second 5’ splice sites, respectively; the third and fourth stop codons are located near the 3’ end of exons 3 and 4, respectively; all these stop codons are in the correct reading frame. E) Suppose you isolate a mutant mouse that has white eyes. When you examine the size of the eye pigment enzyme produced by this mouse, you see that it is 400 amino acids long. Sequence…arrow_forwardSuggest a reason why there are two classes of aminoacyl-tRNA synthetases, with each class recognizing a different face of the tRNA.arrow_forwardQuestion: A gene can best be described as a segment of DNA that A. Transcribed B. Is transcribed as well as the associated regulatory regions C. Encoded for a protein or functional RNA D. Encoded for a protein C. Encoded for a protein as well as the associated regulatory regions Choose the Correct with explanationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY