Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 18, Problem 2RQ
Summary Introduction
To review:
Definition of the following terminologies:
1) Processivity
2) Replisome
3) Exonuclease
4) DNA ligase
5) Replication fork
Introduction:
Deoxyribonucleic acid (
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
QUESTION 25
During lagging strand synthesis of DNA, the RNA primers are replaced with DNA by __________.
DNA Polymerase I
DNA Polymerase II
DNA Polymerase III
Primase
Question Number 3: Write the sequence of the mRNA molecule synthesized from a DNA template coding strand having the sequence 5’ – ATCGTACCGTTA – 3
QUESTION NO. 1 Base excision repair
A. is used only for bases that have been deaminated.
B. uses enzymes called DNA glycosylases to generate an abasic sugar site.
C. removes about 10 to 15 nucleotides.
D. does not require an endonuclease.
E. recognizes a bulky lesion.
QUESTION NO. 2
Termination of a prokaryotic transcriptA. is a random process.
B. requires the presence of the rho subunit of the holoenzyme.
C. does not require rho factor if the end of the gene contains a G-C rich palindrome.
D. is most efficient if there is an A-T-rich segment at the end of the gene.
E. requires an ATPase in addition to rho factor.
QUESTION NO. 3
Eukaryotic transcription
A. is independent of the presence of upstream consensus sequences.
B. may involve a promoter located within the region transcribed rather than upstream.
C. requires a separate promoter region for each of the three ribosomal RNAs transcribed.
D. requires that…
Chapter 18 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 18 - Prob. 1QCh. 18 - Prob. 2QCh. 18 - Prob. 3QCh. 18 - Prob. 4QCh. 18 - Prob. 5QCh. 18 - Prob. 1RQCh. 18 - Prob. 2RQCh. 18 - Prob. 3RQCh. 18 - Prob. 4RQCh. 18 - Prob. 5RQ
Ch. 18 - Prob. 6RQCh. 18 - Prob. 7RQCh. 18 - Prob. 8RQCh. 18 - Prob. 9RQCh. 18 - Prob. 10RQCh. 18 - Prob. 11RQCh. 18 - Prob. 12RQCh. 18 - Prob. 13RQCh. 18 - Prob. 14RQCh. 18 - Prob. 15RQCh. 18 - Prob. 16RQCh. 18 - Prob. 17RQCh. 18 - Prob. 18RQCh. 18 - Prob. 19RQCh. 18 - Prob. 20RQCh. 18 - Prob. 21RQCh. 18 - Prob. 22RQCh. 18 - Prob. 23RQCh. 18 - Prob. 24RQCh. 18 - Prob. 25RQCh. 18 - Prob. 26RQCh. 18 - Prob. 27RQCh. 18 - Prob. 28RQCh. 18 - Prob. 29RQCh. 18 - Prob. 30RQCh. 18 - Prob. 31RQCh. 18 - Prob. 32RQCh. 18 - Prob. 33RQCh. 18 - Prob. 34RQCh. 18 - Prob. 35RQCh. 18 - Prob. 36RQCh. 18 - Prob. 37RQCh. 18 - Prob. 38RQCh. 18 - Prob. 39RQCh. 18 - Prob. 40RQCh. 18 - Prob. 41RQCh. 18 - Prob. 42RQCh. 18 - Prob. 43RQCh. 18 - Prob. 44RQCh. 18 - Prob. 45RQCh. 18 - Prob. 46RQCh. 18 - Prob. 47FBCh. 18 - Prob. 48FBCh. 18 - Prob. 49FBCh. 18 - Prob. 50FBCh. 18 - Prob. 51FBCh. 18 - Prob. 52FBCh. 18 - Prob. 53FBCh. 18 - Prob. 54FBCh. 18 - Prob. 55FBCh. 18 - Prob. 56FBCh. 18 - Prob. 57SACh. 18 - Prob. 58SACh. 18 - Prob. 59SACh. 18 - Prob. 60SACh. 18 - Prob. 61SACh. 18 - Prob. 62TQCh. 18 - Prob. 63TQCh. 18 - Prob. 64TQCh. 18 - Prob. 65TQCh. 18 - Prob. 66TQCh. 18 - Prob. 67TQCh. 18 - Prob. 68TQCh. 18 - Prob. 69TQCh. 18 - Prob. 70TQCh. 18 - Prob. 71TQCh. 18 - Prob. 72TQCh. 18 - Prob. 73TQCh. 18 - Prob. 74TQCh. 18 - Prob. 75TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- What are the Okazaki fragments?arrow_forwardWhat feature of eukaryotic translation is especially responsible for its efficiency?arrow_forwardQUESTION NO. 1 Patients with the rare genetic disease xeroderma pigmentosum (XP) are very sensitive to light and are highly susceptible to skin cancers. The study of such patients has enhanced our knowledge of DNA repair because XP is caused by defective DNA repair nucleotide excision repair. (A variant, XP-V, is deficient in postreplication repair.) In nucleotide excision repair A. removal of the damaged bases occurs on only one strand of the DNA. B. only thymine dimers generated by UV light can be removed . C. the excision nuclease is an exonuclease. D. a single multifunctional enzyme carries out the repair process. E. only the damaged nucleotides are removed. QUESTION NO.2 Homologous recombination: A. occurs only between two segments from the same DNA molecule. B. requires that a specific DNA sequence be present. C. requires one of the duplexes undergoing recombination be nicked in both strands. D. involves a…arrow_forward
- QUESTION 22 The DNA sequences that are most conserved between human and mouse would most likely be located in: A Highly-repeated sequences, such as microsatellite regions B Highly repeated sequences, such as Alu sequences C Moderately-repeated non-coding sequences D Coding regions of single-copy genesarrow_forwardQUESTION 46 Vancomycin and B-lactam antibiotics are similar in what way? OA. They both prevent NAM-NAG glycosdic bond formation in peptidoglycan OB. They both upregulate transpeptidase expression C. They both prevent peptide side chain cross-linking in peptidoglycan O D. They both contain beta lactam ring structures OE. They both cleave NAM-NAG glycosdic bonds in peptidoglycanarrow_forwardQuestion 46 The degeneracy of the genetic code most often involves: the third base of the codon the second base of the codon the first base of the codon two bases of the codon Question 47 Immunological memory is an important feature of: the adaptive immune system the innate immune system Neutrophils macrophagesarrow_forward
- Question 2: Part a: Complete the table describing different components of intron removal from mRNA. Nu:, X and Y refer to B-type chemistry shown on the previous page. (YELLOW table shown) Part b: Complete the table describing different components of group I self-splicing intron removal from 26S rRNA in Tetrahymena. (BLUE table shown) Part c: Draw the intron with an all atom structure for Branchpoint A after intron removal from mRNA Part d: Draw the Group I self-splicing intron with an all atom structure for the Guanosine cofactor after intron removal from 26S rRNA in Tetrahymena.arrow_forwardQuestion 1 Please take the following sequence of DNA and perform 1) DNA Synthesis, 2) Transcription, and 3) Translation in that order. The sequence you get after doing DNA synthesis use for doing Transcription. The sequence you get from transcription use for doing translation. CCATGTTCCTCACCGGGCTATTCAATAAATAAC Answer = 1) ___________________________________________________ 2) ___________________________________________________ 3) ___________________________________________________ asaparrow_forwardHello! Could you kindly assist me in determining if the following statements are true or false? If it is possible, could you write a brief justification to help me comprehend the reason promptly, since I am extremely inexperienced with this topic? Your assistance will undoubtedly aid me in acquiring new information. Thank you! 1. A nucleoside is composed of Sugar and Nucleic Acid-Base.2. The Nucleic Acid base in DNA and RNA are two different set.3. Adenine pairs with Thymine only.4. Amino acid structures contain a Carboxylic group and Amine group.5. he linkage of two amino acids produces a dipeptide and a water molecule.arrow_forward
- QUESTION NO. 1 A transition mutation A. occurs when a purine is substituted for a pyrimidine or vice versa. B. results from the insertion of one or two bases into the DNA chain. C. is most frequently caused by chemicals (like acridine) that intercalate into DNA. D. results from substitution of one purine for another or of one pyrimidine for another. E. always is a missense mutation QUESTION NO. 2 Degeneracy of the generic code denotes the existence of A. multiple codons for a single amino acid. B. codons consisting of only two bases. C. base triplets that do not code for any amino acid. D. different systems in which a given trip let codes for different amino acids. E. codons that include one or more of the unusual bases. QUESTION NO. 3 Replication A. requires that a phosphodiester bond of the incoming dNTP be hydrolyzed in order to be added to the growing chain. B. uses 5' to 3' polymerase activity to synthesize one…arrow_forwardQUESTION 18 tRNA exits the ribosome at the _______________ site. E P Aarrow_forwardAdenine is a niterogenous base or nucleosides?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON