Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 21, Problem 29EQ
Certain hormones, such as epinephrine, can increase the levels of cAMP within cells. Let's suppose you pretreat cells with or without epinephrine and then prepare a cell extract that contains the CREB protein (see Chapter 15 for a description of the CREB protein). You then use an electrophoretic mobility shift assay to analyze the ability of the CREB protein to bind to a DNA fragment containing a cAMP response element (CRE). Describe what the expected results would be.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In the bacteriophage T7 system used to express recombinant proteins, the gene of interest is fused to T7 promoter and T7 RNA polymerase is separately cloned into the same cell. What is the main reason this system uses T7 RNA polymerase instead of relying on the bacterial RNA polymerase?
To restrict the expression of bacterial protein expression
To enhance the amount of recombinant protein expression
To enhance the expression of bacterial protein expression
To restrict the amount of recombinant protein expression
To enable the expression of T7 viral protein expression
There may be more than one correct answer for each
Which of the following motifs can be found in DNA-binding proteins?
a.) helix-loop-helix
b.) zinc fingers
c.) leucine zippers
d.) CpG islands
Which of the following motifs can be used to bind protein dimers?
a.) helix-loop-helix
b.) zinc fingers
c.) leucine zippers
d.) CpG islands
Which of the following are correct regarding enhancers?
a.) Enhancers may be located a great distance from the initiation site they regulate.
b.) Enhancers can be either upstream or downstream from the initiation site.
c.) Enhancers directly bind DNA and prevent binding of activators to the DNA.
d.) Enhancers may function in either orientation (forward or backward).
How do I draw the sequence and explain the process for each step?
Draw the sequence of molecular events that occurs to induce STAT transcription factor localization to the nucleus. To complete this, you will draw the first step that occurs, then draw a new figure with the second step that occurs, then draw a new figure with the third step that occurs, and so on until you have completed all of the steps.
On the drawing, briefly label each molecular event (each drawing). For this brief label, explain what is happening during each step.
Chapter 21 Solutions
Genetics: Analysis and Principles
Ch. 21.1 - 1. Which of the following may be used as a vector...Ch. 21.1 - The restriction enzymes used in gene-cloning...Ch. 21.1 - 3. Which is the proper order of the following...Ch. 21.1 - 4. The function of reverse transcriptase is...Ch. 21.1 - A collection of recombinant vectors that carry...Ch. 21.2 - Prob. 1COMQCh. 21.2 - Prob. 2COMQCh. 21.2 - 3. During real-time PCR, the synthesis of PCR...Ch. 21.3 - When a dideoxyribonucleotide is incorporated into...Ch. 21.4 - 1. The purpose of site-directed mutagenesis and...
Ch. 21.5 - Which of the following methods use(s) a labeled...Ch. 21.5 - 2. Which of the following methods is used to...Ch. 21.5 - During Western blotting, the primary antibody...Ch. 21.6 - 1. In an EMSA, the binding of a protein to...Ch. 21.6 - The basis for DNase I footprinting is that the...Ch. 21 - Discuss three important advances that have...Ch. 21 - Prob. 2CONQCh. 21 - Write a double-stranded DNA sequence that is 20...Ch. 21 - What is cDNA? In eukaryotes, how does cDNA differ...Ch. 21 - 5. Draw the structural feature of a...Ch. 21 - Prob. 1EQCh. 21 - Prob. 2EQCh. 21 - Describe the important features of cloning...Ch. 21 - 4. How does gene cloning produce many copies of a...Ch. 21 - Prob. 5EQCh. 21 - Prob. 6EQCh. 21 - Prob. 7EQCh. 21 - Prob. 8EQCh. 21 - Prob. 9EQCh. 21 - Starting with a sample of RNA that contains the...Ch. 21 - 11. What type of probe is used for real-time PCR?...Ch. 21 - 12. What phase of PCR (exponential, linear, or...Ch. 21 - 13. DNA sequencing can help us to identify...Ch. 21 - A sample of DNA was subjected to automated DNA...Ch. 21 - Prob. 15EQCh. 21 - Prob. 16EQCh. 21 - Prob. 17EQCh. 21 - Prob. 18EQCh. 21 - Prob. 19EQCh. 21 - What is the purpose of a Northern blotting...Ch. 21 - Prob. 21EQCh. 21 - Prob. 22EQCh. 21 - 23. In the Western blot shown here, proteins were...Ch. 21 - If you wanted to know if a protein was made during...Ch. 21 - Prob. 25EQCh. 21 - Prob. 26EQCh. 21 - Prob. 27EQCh. 21 - 28. Describe the rationale behind the...Ch. 21 - Certain hormones, such as epinephrine, can...Ch. 21 - An electrophoretic mobility shift assay can be...Ch. 21 - Prob. 31EQCh. 21 - Prob. 32EQCh. 21 - Prob. 33EQCh. 21 - Prob. 1QSDC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What is the first step in quantifying the relative amounts of mRNA in different tissues? Would this method be useful in determining which immune system genes might be over-expressed in severe Covid cases? Why or why not? Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in…arrow_forwardCpG is an epigenetic term that means: Select one: a. The binding of cytosine with the following guanine on the anti-sense strand b. The binding of the sense cytosine with guanine on the antisense DNA strand c. The binding of cytosine to guanine on the same strand by hydrogen bonds d. The binding of cytosine to guanine on the same strand by phosphodiester bond e. The binding of cytosine to guanine on the opposite strandarrow_forwardA bidirectional enhancer has the following sequence: 5′–GTCA–3′ 3′–CAGT–5′ Which of the following sequences would also be a functional enhancer? a. 5′–ACTG–3′ 3′–TGAC–5′ b. 5′–TGAC–3′ 3′–ACTG–5′ c. 3′–GTCA–5′ 5′–CAGT–3′ d. 3′–TGAC–5′ 5′–ACTG–3′arrow_forward
- Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in immature red blood cells is a reliable indicator that more alpha hemoglobin protein will be made in those cells?arrow_forwardWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forwardA strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? Explain your reasoning for accepting or rejecting each of these five options. a. Transcription does not take place. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands.arrow_forward
- Transformation is a process in which bacteria take up new DNA released by dead cells and integrate it into their own genomes (see p. 265 in Chapter 9). In Streptococcus pneumoniae (which causes many cases of pneumonia, inner-ear infections, and meningitis), the ability to carry out transformation requires from 105 to 124 genes, collectively termed the com regulon. The com regulon is activated in response to a protein called competence-stimulating peptide (CSP), which is produced by the bacteria and exported into the surrounding medium. When enough CSP accumulates, it attaches to a receptor on the bacterial cell membrane, which then activates a regulator protein that stimulates the transcription of genes within the com regulon and sets in motion a series of reactions that ultimately result in transformation. Does the com regulon in Streptococcus pneumoniae exhibit positive or negative control? Explain your answer.arrow_forwardWhich ONE of the following is TRUE concerning the so‐called Philadelphia chromosome? Select one: A.It results in loss of BCR serine‐threonine kinase activity B.It leads to generation of a fusion protein with constitutively active tyrosine kinase activity C.It results from a t(8;21) translocation D.Overexpression of the ABL1 gene results from a translocation that brings a strong gene promoter close to the ABL1 genearrow_forwardResearchers have identified a gene (FR) responsible for watermelon resistance to infection by Dacus curcurbitae (a close relative of Drosophila melanogaster). They isolate RNA from resistant (FR+) and sensitive (fr-) watermelons and use a probe that will recognize both FR+ and fr- transcripts. They also isolate protein from resistant and sensitive watermelons and perform a Western blot using an antibody that can recognize the fr- and FR+ protein. Describe the results illustrated below and give a plausible molecular explanation for these observations.arrow_forward
- How do you think that transcription randomizes positions of nucleosomes and repression restores the ordering after transcription? How might you test to see if there was an exchange of histone subunits during transcription or if the nucleosome is truly transferred as a single unit? Would you expect the DNA band representing the distance from the restriction enzyme site to the hypersensitive site to be a single band or a smear? Defend your answer.arrow_forwardIn the experiment summarized below, scientists were examining the presence of specific sequences in individuals with age. In this experiment they extracted DNA from lymphocytes of various aged individuals and measured the length of a TTAGGG (in kb) repeat they found in their genomic DNA (Left Panel). In the right panel, the scientists measured the length of the same repeats in individuals with lymphocyte failure (red dots most severely effected) that have a mutation in a critical enzyme. Answer the following questions in 2-3 sentences each. A. What is the name of the specific sequence the scientists are measuring in the experiment shown below. B. For the individuals with lymphocyte pathology in the right panel, which gene is likely defective that causes the data shown? C. Explain why the length of the repeat sequence decreases with age.arrow_forwardMutations in the CFTR gene result in cystic fibrosis in humans, a conditions in which abnormal secretions are present in the lungs, pancreas, and sweat glands. The gene was mapped to a 500-kb region on chromosome 7 containing 3 candidate genes. a)Using your knowledge of the disease symptoms, how would you distinguish between the candidate genes to decide which is most likely to encode the CFTR gene? b)How would you prove that your chosen candidate is the CFTR gene?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license