Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 24, Problem 12EQ
Summary Introduction
To review:
A sequence of elements with two examples and the process of determination ofsequence elements by a computer program or by genetic studies.
Introduction:
Deoxyribonucleic acid (DNA) contains the genetic information about the organism and its sequencing is done to identify the order of each
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The goal of many computer programs is to identify sequenceelements within a long segment of DNA. What is a sequenceelement? Give two examples. How is the specific sequence of asequence element determined? In other words, is it determined bythe computer program or by experimentation? Explain.
The goal of many computer programs is to identify sequence elementswithin a long segment of DNA. What is a sequence element? Givetwo examples. How is the specific sequence of a sequence elementdetermined? In other words, is it determined by the computer programor by genetic studies? Explain.
What does the symbol “N” indicate (see the arrow)? Is this a problem for getting an accurate DNA sequence?
The height of the peak in the figure is an indication of the quality of the data, with a high peak correlated with a low error in “base-calling” of perhaps 1 error in 10,000 bases. Is this generally a high-quality DNA sequence for determining the true DNA sequence of the gene studied? How can you tell?
Which end of the sequence shown above is the 5’ end of the sequence being made via PCR.
Chapter 24 Solutions
Genetics: Analysis and Principles
Ch. 24.1 - 1. A DNA microarray is a slide that is dotted...Ch. 24.1 - 2. The purpose of a ChIP-chip assay is to...Ch. 24.1 - 3. For the method of RNA sequencing (RNA-Seq),...Ch. 24.1 - A gene knockout is a gene a. whose function has...Ch. 24.2 - Prob. 1COMQCh. 24.2 - Prob. 2COMQCh. 24.2 - Prob. 3COMQCh. 24.2 - Prob. 4COMQCh. 24.3 - Prob. 1COMQCh. 24.3 - 2. Homologous genes
a. are derived from the same...
Ch. 24.3 - Prob. 3COMQCh. 24 - 1. Give the meanings of the following terms:...Ch. 24 - Prob. 2CONQCh. 24 - What is a database? What types of information are...Ch. 24 - Prob. 4CONQCh. 24 - Prob. 5CONQCh. 24 - Prob. 6CONQCh. 24 - Prob. 7CONQCh. 24 - Prob. 8CONQCh. 24 - Prob. 1EQCh. 24 - In the procedure called RNA sequencing (RNA-Seq),...Ch. 24 - 3. Can two-dimensional gel electrophoresis be used...Ch. 24 - Prob. 4EQCh. 24 - 5. Describe the two general types of protein...Ch. 24 - 6. Discuss the bioinformatics approaches that can...Ch. 24 - 7. What is a motif? Why is it useful for computer...Ch. 24 - Discuss why it is useful to search a database to...Ch. 24 - Prob. 9EQCh. 24 - In this chapter, we considered a computer program...Ch. 24 - Prob. 11EQCh. 24 - Prob. 12EQCh. 24 - Prob. 13EQCh. 24 - Refer to question 3 in More Genetic TIPS before...Ch. 24 - Prob. 15EQCh. 24 - Prob. 16EQCh. 24 - 1. Let’s suppose you are in charge of organizing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and…arrow_forwardLet’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one of which is isolated from the liver of a liver cancer patient and the other one is isolated from the liver of a healthy individual. How you can do that, please explain in detailsarrow_forwardIn general, which part of a DNA sequence will have the best quality? (Ex. Beginning, middle, end?) Why?arrow_forward
- If the GAATTC palindrome repeats are randomly found along the DNA strand, then what can you say about the sizes of the fragments that will be produced when the DNA is digested with a restriction enzyme that recognizes that sequence? How does the total length of the fragments relate to the size of the original DNA fragment?arrow_forwardA researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely? A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA. B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA. C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis. D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.arrow_forwardWhy are closure and completeness important in genome sequencing?arrow_forward
- The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?arrow_forwardExamine the sequence for the DNA fragment below. Your job is to design primers for PCR that would be able to amplify this entire DNA fragment. Your answer must fulfill the following criteria: Design the primers so that they are each 7 bases in length. Please write out the sequence of these primers. Don’t forget to indicate the direction (polarity) of both ends of each primer. Note that only the polarity of one end of one of the template strands of DNA is provided below. Describe where the primer would bind (i.e. top or bottom template strand, left or right side of the DNA strand) Organize your response so that each primer, and associated information, is separated by at least one blank linearrow_forwardThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License