Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 24, Problem 13EQ
Summary Introduction
To review:
The amino acids 101 to 148 of globin polypeptides and answer the following:
A. The amino acids that are most important for the function and structure of globin. Also, the reason for the same.
B. The amino acids that are least important.
Introduction:
Sequence alignment is the alignment of two sequences of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Take a look at the multiple-sequence alignment shown ofthe globin polypeptides, focusing on amino acids 101 to 148.A. Which of these amino acids are likely to be most important forglobin structure and function? Explain why.B. Which are likely to be least important?
For the following sequence, what is the Tm?
5'-AGCTACGATCAGGTCA-3'
A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?
Chapter 24 Solutions
Genetics: Analysis and Principles
Ch. 24.1 - 1. A DNA microarray is a slide that is dotted...Ch. 24.1 - 2. The purpose of a ChIP-chip assay is to...Ch. 24.1 - 3. For the method of RNA sequencing (RNA-Seq),...Ch. 24.1 - A gene knockout is a gene a. whose function has...Ch. 24.2 - Prob. 1COMQCh. 24.2 - Prob. 2COMQCh. 24.2 - Prob. 3COMQCh. 24.2 - Prob. 4COMQCh. 24.3 - Prob. 1COMQCh. 24.3 - 2. Homologous genes
a. are derived from the same...
Ch. 24.3 - Prob. 3COMQCh. 24 - 1. Give the meanings of the following terms:...Ch. 24 - Prob. 2CONQCh. 24 - What is a database? What types of information are...Ch. 24 - Prob. 4CONQCh. 24 - Prob. 5CONQCh. 24 - Prob. 6CONQCh. 24 - Prob. 7CONQCh. 24 - Prob. 8CONQCh. 24 - Prob. 1EQCh. 24 - In the procedure called RNA sequencing (RNA-Seq),...Ch. 24 - 3. Can two-dimensional gel electrophoresis be used...Ch. 24 - Prob. 4EQCh. 24 - 5. Describe the two general types of protein...Ch. 24 - 6. Discuss the bioinformatics approaches that can...Ch. 24 - 7. What is a motif? Why is it useful for computer...Ch. 24 - Discuss why it is useful to search a database to...Ch. 24 - Prob. 9EQCh. 24 - In this chapter, we considered a computer program...Ch. 24 - Prob. 11EQCh. 24 - Prob. 12EQCh. 24 - Prob. 13EQCh. 24 - Refer to question 3 in More Genetic TIPS before...Ch. 24 - Prob. 15EQCh. 24 - Prob. 16EQCh. 24 - 1. Let’s suppose you are in charge of organizing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?arrow_forwardWhich of the following (A through E ) would you expect to find in a nucleotide chain constructed for Sanger sequencing?arrow_forwardIn the procedure shown, why was it necessary to link thecoding sequence for the A or B chains to the sequence forβ-galactosidase? How were the A or B chains separated fromβ-galactosidase after the fusion protein was synthesized in E. coli?arrow_forward
- Based on the N-terminal amino acid sequence, what is the approximate half-life of the protein after methionine is cleaved off?arrow_forward(a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many initiation cycles are needed for a protein with 150 amino acids? (c) How many elongation cycles are needed for a protein with 150 amino acids? (d) How many termination cycles are needed for a protein with 150 amino acids?arrow_forwardA heptapeptide when treated with trypsin produced two peptides. T1 (D, G, Y) and T2 (K, F, V, A). When the heptapeptide was treated with chymotrypsin, three peptides were produced: CT1 (K,,Y, G), CT2 (F,A, V), and CT3 (D). The sequences of these peptides is not known, however. When the peptide was treated with Sanger’s Reagent and hydrolyzed, DNP-K and DNP-A were recovered. What is the amino acid sequence of the heptapeptide?arrow_forward
- A scientist wants to use a technique that allows to shuffle protein domains. Protein A and Protein B are 5 and 7 different domains respectively. If 3 domains from A and 4 domains from B are chosen and paired how many primers are needed to amplify domain sequences to prepare all constructs?arrow_forwardBelow is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' Using the one letter code for Amino Acids, what is the predicted AA sequence of the shortest ORF (from N to C-terminal end)? Using the one letter code for Amino Acids, what is the predicted AA sequence of the longest ORF (from N to C-terminal end)?arrow_forwardE. coli oriC is rich in A · T base pairs. Why is this advantageous?arrow_forward
- What does the third position imply when it comes to tRNA wobble effect and what the wobble effect pairing refers to?arrow_forwardFor the following sequence please design an 18 base pair REVERSE primer. ATGGCTGATAAGATAGAGAGGCATACTTTCAAGGTCTTCAATCAAGATTTCGAAAAAGAGCTGGAGTTTGGATTAGATAGAAAATATTTTTAGarrow_forwardWhat is the net charge on this peptide from the given DNA sequence?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Biomolecules - Protein - Amino acids; Author: Tutorials Point (India) Ltd.;https://www.youtube.com/watch?v=ySNVPDHJ0ek;License: Standard YouTube License, CC-BY