Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 24, Problem 9EQ
Summary Introduction
To review:
The working of the BACKTRANSLATE program, its genetic principle, and the sequence generated by this program.
Introduction:
Amino acids are the organic compounds that form proteins, which are the building blocks of the body. An amino acid contains carboxyl and
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A researcher sequences the genome of a variety of bacterial and eukaryotic cells. She finds that the bacterial genome is smaller, but that there are more genes for a given number of base pairs in the eukaryotic cells. In other words, there are fewer genes per unit of length of DNA in the eukaryotic cells. What do you predict she will find if she examines the DNA more closely?
A. All of the bacterial DNA consists of coding sequences, but this is not true of the eukaryotic DNA.
B. There are more repetitive sequences in the eukaryotic DNA than in the bacterial DNA.
C. There are densely packed genes in the eukaryotic DNA that were not immediately distinguishable during the first analysis.
D. The bacteria have larger quantities of noncoding DNA than the eukaryotic cells.
Which one of the following options would be a good way to identify the location of the poly A tail in the published DNA sequence for a gene?
Look for AATAAA near the 3’ UTR of the DNA sequence.
Look for TTTTTTTTTTTTTT… (many Ts) near the 3’ UTR of the DNA sequence.
Look for AAAAAAAAAAA… (many As) near the 3’ UTR of the DNA sequence.
Look for a stop codon.
DNA from actively dividing bacteria was isolated and examined to find two groups of DNA. One group DNA included very large molecules (thousands or even millions of nucleotides long), and the other included short stretches of DNA (several hundred to a few thousand nucleotides in length). What was the researcher actually seeing in these two groups?
Group of answer choices
mRNA molecules and siRNA molecules
Okazaki fragments and RNA primers
leading strands and Okazaki fragments
leading strands and RNA primers
Chapter 24 Solutions
Genetics: Analysis and Principles
Ch. 24.1 - 1. A DNA microarray is a slide that is dotted...Ch. 24.1 - 2. The purpose of a ChIP-chip assay is to...Ch. 24.1 - 3. For the method of RNA sequencing (RNA-Seq),...Ch. 24.1 - A gene knockout is a gene a. whose function has...Ch. 24.2 - Prob. 1COMQCh. 24.2 - Prob. 2COMQCh. 24.2 - Prob. 3COMQCh. 24.2 - Prob. 4COMQCh. 24.3 - Prob. 1COMQCh. 24.3 - 2. Homologous genes
a. are derived from the same...
Ch. 24.3 - Prob. 3COMQCh. 24 - 1. Give the meanings of the following terms:...Ch. 24 - Prob. 2CONQCh. 24 - What is a database? What types of information are...Ch. 24 - Prob. 4CONQCh. 24 - Prob. 5CONQCh. 24 - Prob. 6CONQCh. 24 - Prob. 7CONQCh. 24 - Prob. 8CONQCh. 24 - Prob. 1EQCh. 24 - In the procedure called RNA sequencing (RNA-Seq),...Ch. 24 - 3. Can two-dimensional gel electrophoresis be used...Ch. 24 - Prob. 4EQCh. 24 - 5. Describe the two general types of protein...Ch. 24 - 6. Discuss the bioinformatics approaches that can...Ch. 24 - 7. What is a motif? Why is it useful for computer...Ch. 24 - Discuss why it is useful to search a database to...Ch. 24 - Prob. 9EQCh. 24 - In this chapter, we considered a computer program...Ch. 24 - Prob. 11EQCh. 24 - Prob. 12EQCh. 24 - Prob. 13EQCh. 24 - Refer to question 3 in More Genetic TIPS before...Ch. 24 - Prob. 15EQCh. 24 - Prob. 16EQCh. 24 - 1. Let’s suppose you are in charge of organizing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forwardWhich of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.arrow_forwardIf the genetic code used 4 bases at a time, how many amino acids could be encoded?arrow_forward
- Complete the table below 6. Below are several DNA sequences that are mutated compared with the wild-type sequence: 3’-T A C T G A C T GA C G A T C-5’. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5’ and 3’ ends) for each mutated DNA sequence, then transcribe (indicating 5’ and 3’ ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid sequence (indicating the N and C termini). What type of mutation is each?6.a. Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of mutation: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Complementary DNA sequence:mRNA sequence transcribed from template:Amino acid sequence of peptide:Type of…arrow_forwardThe following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene. DNA Template Strand: TACCACGTGGACTGAGGACTCCTC 1. What is the minimum number of DNA nucleotides in this whole gene? 3 2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3' TACCACGTGGACTGAGGACTCCTC 5' . 5' ATGGTGCACCTGACTCCTGAGGAG 3' 3. What mRNA will be formed from the template strand of DNA? Sequence of mRNA formed from DNA template strand is shown below: 3' TACCACGTGGACTGAGGACTCCTC 5' . 5'AUGGUGCACCUGACUCCUGAGGAG 3 4. What amino acids will this mRNA code for? 5. If the 20th base in the template strand of the DNA is changed from T to A, rewrite the new template strand below. 6. When the template strand of the DNA is changed, this is referred to as a mutation. What kind of mutation is…arrow_forwardA piece of linear DNA is 700000 base pairs in length and is digested with a restriction enzyme that recognizes a six base pairs site. How many fragments do you predict would be produced? Show all work.arrow_forward
- Design as a set of primers, every 20 nucleotides in length. Using this sequence as a guide, design a set of PCR primers that would amplify ANY particular 500 bp (exactly) segment of this sequence. You pick what part of the sequence you are interested in. Remember that the sequence shown in the database is the coding strand written 5’ to 3’. Remember that your primer set needs to amplify double-stranded DNA. Your forward primer will bind to the end of one strand, the reverse primer must bind to the other... think this through carefully. Remember to type your sequence in all CAPITAL letters (GATC) and in indicating the proper polarity (5’and 3’) on each sequence you made above indicating which is the forward and which is the reverse primer.arrow_forwardA molecular biologist wants to isolate a gene from a scorpion that encodes the deadly toxin found in its stinger, with the ultimate purpose of transferring this gene to bacteria and producing the toxin for use as a commercial pesticide. Isolating the gene requires a DNA library. Should the molecular biologist create a genomic library or a cDNA library? Explain your reasoning.arrow_forwardSuppose you have been directed to find new enzymes to use in the breakdown of wood in order to process biofuel (switchgrass, for example). Suppose you wanted to use fungal or bacterial DNA from the environment in order to do so. DNA can be unwound from the double stranded double helix into single strands, amplified, separated on gels by size, stained with dyes. It can be mutated by a variety of means. It can be sequenced. Describe one or more of the ways that you might manipulate DNA towards the stated goal. Relate the technology you plan to utilize to the structure of DNA. (You can break this into multiple posts, as multiple procedures might be used).arrow_forward
- If you worked backward, starting with the amino acid sequence of the protein, would you obtain the same DNA nucleotide sequence? Why or why not?arrow_forwardLet’s say that you want to find out the difference in nucleotide sequence among two DNA strands, one of which is isolated from the liver of a liver cancer patient and the other one is isolated from the liver of a healthy individual. How you can do that, please explain in detailsarrow_forwardWhich of the following is true regarding next generation sequencing? 1. Next generation sequencing is also known as sequencing by synthesis 2. Next generation sequences uses DDNTPS to identify the base at the end of the nucleotide chain 3. Next generation sequencing will not work if chain terminating nuclear tides are included in the reaction 4. Next generation sequences uses fluorescently labeled ddNTPs instead of radioactivity labeled ddNTPs 5. Next generation sequencing allows hundreds of millions of DNA fragments to be sequenced at the same timearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License