Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 24, Problem 15EQ
Summary Introduction
To analyze:
The given sequence of
Introduction:
Genes are made up of deoxyribonucleic acid (DNA). Genes are generally described as the basic, functional, and physical unit of life. Genes do not code for the proteins but they instruct the other molecules to synthesize the proteins. Proteins are the building blocks of the body, made by the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
How does a bacterial dna look like? Please provide a drawing/picture
Give an example of a gene sequence that can be used to classify some bacterial or eukaryotic species.
Follow these directions to access the entries for PTGS1 and PTGS2 in the “Gene” database at the
NCBI Website:A. First, go to the NCBI homepage using the link on the lab webpage, or by going to:
http://www.ncbi.nlm.nih.gov
Select “Gene” from the database pulldown menu. Type “PTGS” in the search box, then
click “Go.”
Scan the results for the “Homo sapiens” entries. There should be one called “PTGS1” and
one called “PTGS2.”
Select each entry by clicking on its name, then read the paragraph under the “Summary”
section for each entry.
The drug Celebrex selectively inhibits PTGS2 while aspirin and other NSAID’s inhibit
both PTGS1 and PTGS2 in the same way. Why do you think researchers wanted to
discover a selective inhibitor to PTGS2?
2. Describe how studying 3-D structures of PTGS1 and PTGS2 could help researchers
design a drug that binds to PTGS1, but not to PTGS2.
Chapter 24 Solutions
Genetics: Analysis and Principles
Ch. 24.1 - 1. A DNA microarray is a slide that is dotted...Ch. 24.1 - 2. The purpose of a ChIP-chip assay is to...Ch. 24.1 - 3. For the method of RNA sequencing (RNA-Seq),...Ch. 24.1 - A gene knockout is a gene a. whose function has...Ch. 24.2 - Prob. 1COMQCh. 24.2 - Prob. 2COMQCh. 24.2 - Prob. 3COMQCh. 24.2 - Prob. 4COMQCh. 24.3 - Prob. 1COMQCh. 24.3 - 2. Homologous genes
a. are derived from the same...
Ch. 24.3 - Prob. 3COMQCh. 24 - 1. Give the meanings of the following terms:...Ch. 24 - Prob. 2CONQCh. 24 - What is a database? What types of information are...Ch. 24 - Prob. 4CONQCh. 24 - Prob. 5CONQCh. 24 - Prob. 6CONQCh. 24 - Prob. 7CONQCh. 24 - Prob. 8CONQCh. 24 - Prob. 1EQCh. 24 - In the procedure called RNA sequencing (RNA-Seq),...Ch. 24 - 3. Can two-dimensional gel electrophoresis be used...Ch. 24 - Prob. 4EQCh. 24 - 5. Describe the two general types of protein...Ch. 24 - 6. Discuss the bioinformatics approaches that can...Ch. 24 - 7. What is a motif? Why is it useful for computer...Ch. 24 - Discuss why it is useful to search a database to...Ch. 24 - Prob. 9EQCh. 24 - In this chapter, we considered a computer program...Ch. 24 - Prob. 11EQCh. 24 - Prob. 12EQCh. 24 - Prob. 13EQCh. 24 - Refer to question 3 in More Genetic TIPS before...Ch. 24 - Prob. 15EQCh. 24 - Prob. 16EQCh. 24 - 1. Let’s suppose you are in charge of organizing...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Give an example of a journal that is about genetic switches involving rna molecules. Give the author’s name the title of the study and the link to the journalarrow_forwardUsing the diagram below describe the significance of DNA sequencing for identification of mutations.arrow_forwardUsing suitable illustrations describe a method to sequence a fragment of DNA and include how the same method can be used to sequence RNA.arrow_forward
- Make a simple illustration to relate the different kinds of DNA to its function.arrow_forwardUse at least 25 of the 40 terms below to create a concept map, linking the term together with meaningful descriptor arrows. Use at least 25 different terms. Terms Deoxyribonucleic Acid, Ribonucleic Acid, Nucleotide, Amino Acid , Protein, DNA, Polymerase, Primase, Ligase, Helicas,e RNA Polymerase, mRNA, tRNA, rRNA, Ribosome, Codon, Anti-Codon, 3-OH, 5-P, Double Helix, Adenin,e Cytosine, Guanine, Thymine, Uracil, Purine, Pyrimidines, Single Helix, Transscription, Translation, Chromatin, Antiparallel, Telomere, Nucleus, Origin of Replication, Intron, Exon, Poly-A, Tail, Genetic Code, in the form of a, is found in eukaryotic cell'sarrow_forwardSelect the sequences that would be recognized by a restriction enzyme? (There can be more than one answer) A) 3'-TAGCTA-5' B) 5'CGATTC-3' C) 5'GAATTC- 3' D) 5'GAGCTC-3'arrow_forward
- Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’ 5’ ATGGCCGGATAGATCCCGGTACCGAATTAAGGG3’arrow_forwardDescribe the mutation that created the Hbs allele: type of mutation, location of mutation on HbA sequence (#of bases from beginning of sequence), nucleotide change (from which base to which base?) Answer in a paragraph form and answer it straight forward...arrow_forwardUsing the example above, transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence.arrow_forward
- What are three benefits Ion torrent sequencing has over sanger sequencingarrow_forwardGiven a polynucleotide sequence such as GAATTC,explain what further information you would need inorder to identify which is the 5′ end. (See Figure 16.5.)arrow_forwardname the enzyme which is used to combine or glue two different molecules of a fregment of the DNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license