Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 10QP
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site.
- a. normal-length transcript, normal-length nonfunctional protein
- b. normal-length transcript, no protein made
- c. normal-length transcript, normal-length mRNA, short nonfunctional protein
- d. normal-length transcript, longer mRNA, shorter nonfunctional protein
- e. transcript never made
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
a) What is a gene promoter? b) What proteins bind to a promoter? c) What do those proteins do to control gene expression?
Consider the following mRNA base sequence
5' CUG-CAC 3'
(a) What dipeptide is coded for by this mRNA?
(b) What dipeptide is formed if a mutation converts CUG to CUU?
(c) What dipeptide is formed if a mutation converts CAC to CGC?
(d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
a)
introns removed
b)
exons removed
c)
5' cap added
d)
3' cap added
e)
poly G tail added to 5' end
f)
poly A tail added to 3' end
g)
a cap binding protein added to the 5' end
h)
poly A binding proteins added
i)
of these answers, b, c, and f only
j)
of these answers, a, c, and f only
.
k)
of these answers a, c, f, g, and h only
Pre-mRNA must undergo which of the following modifications before leaving the nucleus?
Chapter 9 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the following is not a function of the 5’ cap and 3’ poly-A tail of a mature eukaryotic mRNA molecule? a. To facilitate splicing b. To prevent mRNA degradation c. To aid export of the mature transcript to the cytoplasm d. To aid ribosome binding to the transcriptarrow_forwardA given section of DNA with the sequence TACACTGGTCAT is transcribed. What is the corresponding sequence on the mRNA transcription? Group of answer choices A: TACACTGGTCAT B: ATGTGACCAGTA C: UACACUGGUCAU D: AUGUGACCAGUA None of the answers providedarrow_forwardBelow is a graphical representation of eukaryotic precursor mRNA. A. Outline each modification that must happen to get a mature m-RNA. B. How does the absence of introns in prokaryotic genes affect prokaryotic gene expression? C. How will gene expression be affected if all of the spliceosomes are removed from the bacteria sample? Explain.arrow_forward
- Consider a gene sequence whose promoter has acquired a mutation. Although this is a problem, this will not cause a missense mutation. Please answer the following questions. 1. Explain why the outcome in this scenario is NOT a missense mutation. 2. Describe the purpose of a gene's promoter.arrow_forwardWhich sequence is most likely to be found in a promoter? a) CGGTGTATATCGTAC b) GTACAGTCATCCCGT c) AAATCTACTACGATT d) GGGTTGGGTTGGGTTarrow_forwardGiven the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dna (coding strand) b. predict the transcribed product of the coding strand (mRNA transcript) c. given the genetic code table, predict the amino acid sequence of the transcript d. predict the amino acid sequence if the A underlined became deletedarrow_forward
- Sickle cell disease is caused by a substitution in the beta globin gene. As a result, one amino acid is different in the mutant protein. Which of the following region is likely to be affected in the sickle cell allele? A. The promoter region B. The 5' UTR region C. The coding region D. The 3' UTRarrow_forwardFor each statement about gene expression mechanisms, choose the correct end to the sentence. For each gene, the template strand for transcription is determined by…. The direction of translation is determined by…… The tissue-specificity of protein production is determined by…. choices: a. location of the start codon b. location of the promoter c. direction of polymerization by RNA polymerase d. none of these e. direction of movement of ribosomes f. overall orientation of the chromosomearrow_forwardWhat happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.arrow_forward
- Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two copies of the gene has the disease, but a person with one copy of the gene does not have the disease. The diagram shows how this mutation affects an organism. Use the image to answer the question. Which conclusion can you draw based on the diagram? A. The mutation changed the amino acid sequence during the translation step. B. A mutation caused the information in DNA to change during the transcription step. C. A change in the DNA sequence can be carried over to the translation and transcription steps. D. The change that affected the translation and transcription steps does not affect the organism.arrow_forwardGeneticists are studying a malfunctioning protein that causes impaired endothelial cell migration and angiogenesis. They have noticed that the amino acid sequence of the protein is truncated compared to normal controls. The mutated mRNA strand is isolated, and analysis shows a nonsense mutation located near the 3' end of the coding region. The 3' terminal coding sequence of the abnormal mRNA strand is shown below. 5`- AUG-ACC-ACU-CCA-CUG-UUG-UUC-CAA-GGG-GAG-AGC-UAG-GUC-CGG-GGC-GGA-AAA-UUU-UAA-3` Write down the tRNA anticodon responsible for adding the last amino acid?arrow_forwardBelow is an mRNA molecule in its wild type form. 5’ CCGUACAUGGUGAAAAGUCAAUGACCAAA 3’ An individual experiences a DNA mutation that impacts the transcription of the mRNA molecule. The resulting mutated mRNA molecule is: 5’ CCGUACAUGGUGAAAGGUCAAUGACCAAA 3’ What type of mutation has occurred? (max 1 sentence) Does this result in an amino acid change? If yes, identify the change that has occurred. (max 1 sentence) Based on your answer to Part 2, will this mutation impact the structure of the protein? Justify your answer. (1-2 sentences) Responding in point form is allowed!arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY