Human Heredity: Principles and Issues (MindTap Course List)
11th Edition
ISBN: 9781305251052
Author: Michael Cummings
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 17QP
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5′ and the 3′ ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message.
DNA:
mRNA: 5′-CCGCAUGUUCAGUGGGCGUAAACACUGA-3′
protein:
tRNA:
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Which of the following best describes the initiation of translation?
A. The mRNA binds the large ribosomal subunit. The start codon is identified and an rRNA with methionine is bound to the start codon.
B. The mRNA binds the small ribosomal subunit. The start codon is identified and the large subunit is recruited.
C. The mRNA binds the small ribosomal subunit. The start codon is identified and a tRNA with methionine is bound to the start codon.
D. The mRNA binds the small ribosomal subunit. The start codon is identified and the tRNA with methionine enters the A site.
What is the complementary DNA sequence to the following DNA sequence?
ATGCCATCG ____________________________
Write the mRNA codon sequence for the following DNA sequence.
CTGCACTGA ____________________________
Write the anticodon tRNA sequence for the following mRNA sequence.
UACGACUAG ____________________________
Name the amino acids that use the following mRNA codons.
CAU ______________________________
AUG ______________________________
AAG ______________________________
CCC ______________________________
Name the amino acids that use the following DNA codons
TAT ______________________________
CGA ______________________________
List the amino acid sequence for the following mRNA code. Be sure that you start with the first start codon you get to and then proceed to list the amino acids until you get to a stop codon.
CGUAUGACUGGAAUACUUUAGCCAGCU
__________________________________________________________________
Chapter 9 Solutions
Human Heredity: Principles and Issues (MindTap Course List)
Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9.6 - Antibiotics and Protein Synthesis Antibiotics are...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - There have been recurring cases of mad-cow disease...Ch. 9 - The Link Between Genes and proteins The genetic...Ch. 9 - Define replication, transcription, and...Ch. 9 - If the genetic code used 4 bases at a time, how...Ch. 9 - If the genetic code uses triplets, how many...Ch. 9 - What is the start codon? What are the stop codons?...
Ch. 9 - Is an entire chromosome made into an mRNA during...Ch. 9 - The promoter and terminator regions of genes are...Ch. 9 - The following segment of DNA codes for a protein....Ch. 9 - What are the three modifications made to pre-mRNA...Ch. 9 - The pre-mRNA transcript and protein made by...Ch. 9 - Briefly describe the function of the following in...Ch. 9 - Prob. 12QPCh. 9 - Determine the percent of the following gene that...Ch. 9 - How many kilobases of the DNA strand below will...Ch. 9 - Prob. 15QPCh. 9 - Given the following tRNA anticodon sequence,...Ch. 9 - Given the following mRNA, write the...Ch. 9 - The following is a portion of a protein:...Ch. 9 - Below is the structure of glycine. Draw a...Ch. 9 - Indicate in which category, transcription or...Ch. 9 - Prob. 21QPCh. 9 - Polypeptide folding is often mediated by other...Ch. 9 - Do mutations in DNA alter proteins all the time?Ch. 9 - a. Can a mutation change a proteins tertiary...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAarrow_forwardA certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).arrow_forwardFor the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCCarrow_forward
- If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the abovearrow_forwardBelow is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?arrow_forwardWrite down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAGarrow_forward
- Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOParrow_forwardif the following DNA sequence were transcribed, which of the following describes the output of this process? 3'- TCTGGACA-5' A. This would produce a protein that looks like 5'- A G A C C U G U -3' B. This would produce a tRNA that looks like 3'- A G AC C U G U -5' C. This would produce an mRNA that looks like this: 5'- A G AC C U G U -3' D. This would produce an mRNA that looks like 3'- U C U G G A CA -5' E. This would produce another strand of DNA that 0ok like 5-AG ACCT GT-3. ..arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forward
- Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the table below. DNA triplet mRNA codon tRNA anticodon Amino Acid AAG GGC CAG UUA AAA GTA CUC ACA TAT AGC AUU CCA GGCarrow_forwardGiven the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'arrow_forwardMatch the following with the correct nucleic acid. (mRNA, tRNA, rRNA, or All RNA) 1. This molecule is complementary to DNA. 2. This molecule is part of translation. 3. This molecule is part of the ribosome. 4. This molecule contains anticodons. 5. This molecule is esponsible for bringing amino acids to the ribosome. 6. DNA is used as a template to create this type of RNA molecule. 7. This molecule is part of transcription. 8. This molecule contains codons.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY