5' Cap1. Eukaryotes onlyPribnow box2. Prokaryotes onlyActivator protein3. Eukaryotes and ProkaryotesTranscription factors (otherthan sigma factor)Hairpin (rho independent)transcriptional terminationSilencerRepressor Protein21RNA polymerase IISigma factorMRNA splicing Rho dependent terminationElongation of MRNA in 5'to 3' directionEnhancerPoly-A cleavage site-35 regionPromoterТАТА box5 Сap1. Eukaryotes onlyPribnow box2. Prokaryotes onlyActivator protein3.Eukaryotes and Prokaryotes

The prokaryotes and eukaryotes both contain DNA as genetic material. The small segment of DNA is…

5' Cap 1. Eukaryotes only Pribnow box 2. Prokaryotes only Activator protein 3. Eukaryotes and Prokaryotes Transcription factors (other than sigma factor) Hairpin (rho independent) transcriptional termination Silencer Repressor Protein 2 RNA polymerase II Sigma factor MRNA splicing

5' Cap 1. Eukaryotes only Pribnow box 2. Prokaryotes only Activator protein 3. Eukaryotes and Prokaryotes Transcription factors (other than sigma factor) Hairpin (rho independent) transcriptional termination Silencer Repressor Protein 2 RNA polymerase II Sigma factor MRNA splicing

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter10: Control Of Gene Expression

Section: Chapter Questions

Problem 2SQ

See similar textbooks

Related questions

Q: Which molecules recognize the TATA box before RNA polymerase binds to the promoter region?…

A: The TATA box, also known as the Goldberg–Hogness box, is a DNA sequence present in the central…

Q: MRNA HRNA Topoisomerase DNA gyrase Sense strand Bubble Promoter region Antisense strand Coding…

A: Central dogma means the flow of genetic information in the cell. It states that the 3 main process…

Q: Write TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. 1.The lac…

A: Introduction :- LacZ, LacY, and LacA are the three coding regions that make up the lac operon. The…

Q: 2 of 22 The direction of synthesis for a new MRNA molecule is from a template strand, and this…

A: Transcription is the process of synthesis of mRNA from a DNA molecule. The process of transcription…

Q: Chapter 17: If given the following coding strand of DNA, what is the MRNA? What TRNA will be…

A: There are two types of nucleic acids present in the cells- DNA and RNA. DNA carries the genetic…

Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…

A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…

Q: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader…

A: We all know that Central dogma of life is a unidirectional flow of information from master copy DNA…

Q: What is the difference between Rho Dependent and Rho Independent termination in prokaryotes?

A: Introduction : Transcription is the process in which RNA is synthesized by taking DNA as a template…

Q: 6)Select ALL of the following that apply to transcription. Select one or more: a. occurs in the…

A: Transcription is that the method by which the information during a strand of deoxyribonucleic acid…

Q: What is the central dogma? What are the compounds involved in this process? (Keywords: transcription…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Q: D. Evaluation (Pagtataya) • Fill in the pill-shaped bubbles in the flowchart using the terms in the…

A: This is the description of gene expression in which a part of the gene is expressed into a…

Q: Dystrophin gene structe 3 T Elijah's X G Promoter Exon 19 Exon 52 Intron Exon 53 T Liam's X affected…

A: The gene is the sequence of nucleotide that encode a particular protein.

Q: 1. Write the complementary coding strand sequence 5' GGG ATG TCA CAC ATA TTT 2. Write the mRNA…

A: The coding strand of DNA is the one that contains the instructions for the gene in concern. The…

Q: 28) Use this model of a eukaryotic transcript to answer the following questiofn. E = exon and I=…

A: Exons- They are coding sequences present on the primary mRNA transcript as well as the mature mRNA.…

Q: 8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA…

A: Gene expression is a process in which first transcription occurs that is formation of RNA occurs…

Q: Explain why the glucocorticoid receptor binds next to the core promoter of some genes, but not next…

A: Glucocorticoids are corticosteroids that are a class of steroid hormones. They are the…

Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…

A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…

Q: 20 of 22 If a strand of MRNA has the sequence 5'-CUGUCA...ACUC-3' (with [….] representing the…

A: Transcription process takes place in the nucleus. It is responsible for producing mRNA from template…

Q: Translation initiation sequences can cause different open reading frames to be translated…

A: Operons are DNA segments that include groups of associated genes. They consist of a promoter region,…

Q: 26) The accompanying drawing represents simultaneous transcription and translation in E. coli. The…

A: Protein synthesis takes place in two stages, namely, transcription and translation. Transcription is…

Q: 8) Which of these describes the function of RNA polymerase? A. Amplifies the “message" by making…

A: Need to find which of the following is correct regarding RNA polymerase function.

Q: How does chloramphenicol inhibits bacterial translation ? Group of answer choices changes shape of…

A: Antimicrobial agents are drugs that are routinely used to treat microbial illnesses. Antimicrobial…

Q: 1. Which of the following catalyzes formation of peptide bonds between amino acids during…

A: 1. Peptidyl transferase is a protein synthesis enzyme that catalyses the addition of an amino acid…

Q: 2. For each of the following types of gene regulation, indicate whether it occurs in eukaryotes…

A: Gene regulation is the term used to describe any mechanism used by a cell to increase or decrease…

Q: 17. Lariat formation is a step in which of the following: transcription post-translation…

A: Lariat formation is a step in transcription.

Q: Hello, my question is in the picture below. Thank you in advance!

A: Transcription is the process of converting DNA into m-RNA in the presence of enzyme RNA polymerase.…

Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…

A: "Transcription" and "Translation" are two important processes that take place inside the cell for…

Q: Gene (a) regulation prokaryotic genes are often grouped into" is a normal gene that can be mutated…

A: Gene regulation is the process which ensure expression of particular gene at particular time by…

Q: 10. Given the following prokaryote sequence of DNA: Identify if any promoter sequences are present…

A: Disclaimer : Since you have posted a question with multiple subparts, we will solve first three sub…

Q: 1. True or False a) DNA bases, when coiled to histones, become inaccessible to RNA polymerase. b)…

A: Transcription is the process by which the information of DNA are copied into mRNA and this process…

Q: in 3 5% Shown below is a schematic diagram showing a 3000 bp region of yeast genomic DNA. (Note:…

A: DNA: The hereditary substance in humans and almost all other animals is DNA, or deoxyribonucleic…

Q: 6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan…

A: Introduction Gene Regulation: Expression of gene is highly regulated in both prokaryotes as well as…

Q: 17. NF1 protein ---- Ras signaling. a. activates b. inhibits 18. The deacetylation of the histones…

A: *NOTE: Kindly repost for other questions. Dear Student as per the guidelines we are supposed to…

Q: sequence is 3 A DNA sequence before and after rep from left to right. The table below shows which…

A: DNA ( Deoxyribonucleic acid ) is a genetic material in most of organism . It is two stranded ,…

Q: 10. Why does a cDNA copy of a eukaryotic mRNA gene need to be made in order to determine the…

A: Introduction :- DNA acts as the genetic material of the cell . DNA is made up of two strands , and…

Q: I. Answer the following: 1. What are the main elements of the lac operon and their functions? 2.…

A: Definition:- An operon is a group of genes that are transcribed at the same time. These are a…

Q: Which of the following is a true statement concerning condons

A: Codons are nucleotide triplets that are read together in order to specify amino acids during…

Q: Innoor an A |RROTEL HERE........god ba

A: In this question we have to describe about the process of translution.

Q: 10. Messenger RNA often encodes more that one biological activity. These activities can then be…

A: Introduction: Messenger RNA (mRNA) is a single-stranded RNA that carries hereditary information from…

Q: 5'.GTCATCTTGACATTG... 3' The same strand now has a single base insertion of an A, indicated in blue.…

A: A mutation is a change in our DNA sequence that happens as a result of errors in DNA copying or…

Q: cion 18 latch Column A with Column B. v transports amino acids to the site of protein synthesis A…

A: The ribonucleic acid consists of a single stranded structure which consists of a ribose sugar. It…

Q: B- TRANSCRIPTION 1. Use the DNA code provided to copy an mRNA message. (DNA) a. TAC GGA CAT (DNA) b.…

A: The central dogma explains that the information from the DNA will be passed in a sequence fashion…

Q: Mutation #2: • Change the Mutation to RED TACACC IIGGCGACGACT AUGUGG A ACCG CU G CUGA MET -TRP- ASN…

A: Original DNA sequence TAC ACC TTG GCG ACG ACT mRNA sequence AUG UGG AAC CGC UGC UGAAmino…

Q: 25. An RNA chain being synthesized grows in the direction. a. 5' to 3' Ob. 3' to 5' c. either…

A: Transcription is the process in which a gene's DNA sequence is copied to make an RNA molecule. The…

Q: PPPP 2.7 essage hatentaded pruteiis? gene iS shown below (starting with ATG), What is the resulting…

A: We are authorized to answer one question at a time since you have not mentioned which question…

Q: 5'.GTCTCTTGACATTG... 3' What is the MRNA sequence transcribed from this sequence (assume the…

A: Ans ) Always Guanine codes for cysteine only .. That is G-C Given.…

Q: (6C) The diagram below shows the process of translation. protein moleçule forming Bead and re-read…

A: which of the following describe the role of the ribosome :

Q: DNA ATG AGG 11 13 --UCA- MRNA 12 14 TRNA 10 Ser 15

A: The base pairing of DNA and RNA differ slightly in their nucleotide bases. DNA uses the bases…

Q: ads 5' to 3' right to left. The nucleotides are numbered 1 to 100. REMINDER: For thi oblem,…

A: The central dogma of molecular biology is a metabolic process of cell where one strand of the double…

Q: shown below is a schematic drawing of a gene, with the transcription unit divided into numbered…

A: A gene is a stretch of nucleotides present in the DNA. DNA or deoxyribonucleic acid is a polymer of…

Question

5' Cap
1. Eukaryotes only
Pribnow box
2. Prokaryotes only
Activator protein
3. Eukaryotes and Prokaryotes
Transcription factors (other
than sigma factor)
Hairpin (rho independent)
transcriptional termination
Silencer
Repressor Protein
21
RNA polymerase II
Sigma factor
MRNA splicing

Rho dependent termination
Elongation of MRNA in 5'
to 3' direction
Enhancer
Poly-A cleavage site
-35 region
Promoter
ТАТА box
5 Сap
1. Eukaryotes only
Pribnow box
2. Prokaryotes only
Activator protein
3.
Eukaryotes and Prokaryotes

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1- Introduction

VIEW

Step 2- Answer

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The coding (or “sense”)strand(again noticename ANDthe directionality)of DNAthat is known to encode the C-terminal end of a long E. coliprotein has the following nucleotide sequence:5′–CCATGCAAAGTAATAGGT–3′Give the sequence of the last three amino acids of the protein (label the C-terminus).
19Eukaryotic messenger RNA and hnRNA both have poly (A) tails at their 3'-ends. Yesorno 20Messenger RNA splicing and export are uncoupled processes. Yesorno twenty oneWhich of the following plays an important role in directing newly synthesized proteins to specific cellular destinations?A.signal sequenceb.nuclear localization signalc.chain elongation stretchD.Shine – Dalgarno
PLEASE FL OUT TABLE USING INSTRXUTIONS -USE BASE PAIRING RULES TO COMPLETE SECOND COLUMN FOR EACH MUTATION WRIYE IN ANY MRNA DOEONS RHAT WILL BE FHANGED AS THE REEULR OF RHE MURATION AND USE X MARKS RO INDÍCATE DOONS THAT WONT BE FHANGES CIRCLE STOP CODONS
Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript). Strand 1 3’ End TTG CTT CAC CTT GCG CGC CCG CGC TAA TTG 5’ end mRNA
52Protein synthesis takes place on ( ). 53The eukaryotic pathway of polypeptide chain elongation is the same as the bacterial pathway except that eEF1A and eEF2 replace eF1A and EF2. Yesorno 54Which experiment show that σ70-RNA polymerase combines with promoter DNA to form a closed and an open complex?A.Footprintingb.Southern blottingc.ComplementationD.DNase protection
49Eukaryotic RNA polymerases can be distinguished by their sensitivities to ( ). 50Each bacterial mRNA open reading frame has its own ( ) codon. 51Two nuclear splicing intermediates resemble ______________. A.helicesb.lariatsc.hairpinsD.projections
From this DNA sequence DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’, change the third base in codon 4 to show missensemutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:Identify the type of base pair substitution that you applied in codon 4
The eukaryotic mature mRNA sequence will be translated into a polypeptide that is _____ amino acids long (hint remember to "be a ribosome" and scan for the AUG and look out for stop codons!). 5’-CCATTCAUGUUUGGUGGCUAACCA-3’
A pre-initation complex (PIC) is required for transcription to begin. State which TFII protein has catalytic function.
RIPs as Cancer Drugs Researchers are taking a page from the structure-function relationship of RIPs in their quest for cancer treatments. The most toxic RIPs, remember, have one domain that interferes with ribosomes, and another that carries them into cells. Melissa Cheung and her colleagues incorporated a peptide that binds to skin cancer cells into the enzymatic part of an RIP, the E. coli Shiga-like toxin. The researchers created a new RIP that specifically kills .skin cancer cells, which are notoriously resistant to established therapies. Some of their results are shown in FIGURE 9.17. FIGURE 9.17 Effect of an engineered RIP on cancer cells. The model on the left shows the enzyme portion of E. coli Shiga-like toxin engineered to carry a small sequence of amino acids (in blue) that targets skin cancer cells. (Red indicates the active site.) The graph on the right shows the effect of this engineered RIP on human cancer cells of the skin (); breast () liver (); and prostate (). Which cells had the greatest response to an increase in concentration of the engineered RIP?
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
A scientist identifies a pre-mRNA with the following structure. What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5' cap and 3’ poly-A tail? 220bp 295bp 140bp 435bp