Concepts of Genetics (11th Edition)
11th Edition
ISBN: 9780321948915
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 25, Problem 32ESP
Shown below are two homologous lengths of the alpha and beta chains of human hemoglobin. Consult a genetic code dictionary (Figure 13.7), and determine how many amino acid substitutions may have occurred as a result of a single
Alpha: ala val ala his val asp asp met pro
Beta: gly leu ala his leu asp asn leu lys
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance.
Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lys
A wildtype gene produces the polypeptide sequence:
Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly
Each of the following polypeptide sequences is the result of a single mutation. Identify the
most likely type of mutation causing each, be as specific as possible.
M1:Met-Ser-Ser-Arg-Leu-Glu-Gly
missense mutation
M2:Met-Ser-Pro
M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys
M4:Met-Ser-Pro-Glu-Gly
nonsense mutation
frameshift insertion
in frame deletion
M5:Met-Ser-Pro-Arg-Leu-Glu-Gly
in frame insertion
Below is the DNA base sequence for the normal protein for normal hemoglobin and the base sequence for (abnormal) sickle cell hemoglobin:
Normal GGG CTT CTT TTT
Sickle GGG CAT CTT TTT
A)Transcribe and translate the normal and sickle cell DNA.
B)Identify this as a point or frameshift mutation. Explain.
Chapter 25 Solutions
Concepts of Genetics (11th Edition)
Ch. 25 - Prob. 1NSTCh. 25 - Prob. 2NSTCh. 25 - If the albino phenotype occurs in 1/10,000...Ch. 25 - A prospective groom, who is unaffected, has a...Ch. 25 - Prob. 1CSCh. 25 - Prob. 2CSCh. 25 - Prob. 3CSCh. 25 - HOW DO WE KNOW? Population geneticists study...Ch. 25 - CONCEPT QUESTION Read the Chapter Concepts list on...Ch. 25 - Price et al. [(1999).J. Bacteriol181:2358-2362)...
Ch. 25 - The genetic difference between two Drosophila...Ch. 25 - The use of nucleotide sequence data to measure...Ch. 25 - The ability to taste the compound PTC is...Ch. 25 - Prob. 7PDQCh. 25 - What must be assumed in order to validate the...Ch. 25 - In a population where only the total number of...Ch. 25 - Determine whether the following two sets of data...Ch. 25 - If 4 percent of a population in equilibrium...Ch. 25 - Consider a population in which the frequency of...Ch. 25 - If the initial allele frequencies are p = 0.5 and...Ch. 25 - Under what circumstances might a lethal dominant...Ch. 25 - Assume that a recessive autosomal disorder occurs...Ch. 25 - One of the first Mendelian traits identified in...Ch. 25 - Describe how populations with substantial genetic...Ch. 25 - Achondroplasia is a dominant trait that causes a...Ch. 25 - Prob. 19PDQCh. 25 - Prob. 20PDQCh. 25 - A botanist studying water lilies in an isolated...Ch. 25 - A farmer plants transgenic Bt corn that is...Ch. 25 - In an isolated population of 50 desert bighorn...Ch. 25 - To increase genetic diversity in the bighorn sheep...Ch. 25 - What genetic changes take place during speciation?Ch. 25 - Some critics have warned that the use of gene...Ch. 25 - A form of dwarfism known as Ellisvan Creveld...Ch. 25 - Prob. 28ESPCh. 25 - What are the two groups of reproductive isolating...Ch. 25 - The original source of new alleles, upon which...Ch. 25 - A number of comparisons of nucleotide sequences...Ch. 25 - Shown below are two homologous lengths of the...Ch. 25 - Recent reconstructions of evolutionary history are...Ch. 25 - Prob. 34ESP
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?arrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. For each mutant, indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 1: Met-Ser-Ser-Arg-Leu-Glu-Gly b. Mutant 2: Met-Ser-Pro c. Mutant 3: Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys d. Mutant 4: Met-Ser-Pro-Glu-Gly e. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forwardWhat is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)arrow_forward
- For each altered nucleotide sequence give the type of mutation (effect at the DNA/nucleotide level; see #1 above)arrow_forwardThe following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forwardA normal polypeptide and a mutant of the polypeptide were hydrolyzed by an endopeptidase under the same conditions. The normal and mutantpolypeptide differ by one amino acid. The fingerprints of the peptides obtained from the two polypeptides are shown below. What kind of amino acid substitution occurred as a result of the mutation? (That is, is the substituted amino acid more or less polar than the original amino acid? Is its pI lower or higher?) (Hint: Photocopy the fingerprints, cut them out, and overlay them.)arrow_forward
- In the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. MMutant 4: Met-Ser-Pro-Glu-Glarrow_forwardA polypeptide has the following amino acid sequence: Met-Ser-Pro-Arg-Leu-Glu-Gly The amino acid sequence of this polypeptide was determined in a series of mutants listed in parts a through e. indicate the type of mutation that occurred in the DNA (single-base substitution, insertion, deletion) and the phenotypic effect of the mutation (nonsense mutation, missense mutation, frameshift, etc.). a. Mutant 5: Met-Ser-Pro-Arg-Leu-Leu-Glu-Glyarrow_forward
- List two possible missense mutation effects on the new polypeptide.arrow_forwardYou have discovered a novel protein that has a pI = 5.5. To study the functional properties of this new protein, your research group has made a mutant that contains two amino acid changes—namely, a surface Phe residue in the normal protein has been replaced by His (side chain pKa = 6.1) and asurface Gln has been replaced by Glu (side chain pKa = 6.0). Is the pI of themutant protein predicted to be greater than, less than, or the same as the pIof the normal protein? Support your answer with the appropriate calculation.arrow_forwardDetermine the isoelectric point of the peptide product of the mutated sequence: 5' - AUG UCC AUG AUU CUG GAA AUU ACC UCC AUC AUG AAG CGC UGA CCC AUU AUU AA - 3'arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY